Incidental Mutation 'R1019:Lipo2'
ID96807
Institutional Source Beutler Lab
Gene Symbol Lipo2
Ensembl Gene ENSMUSG00000087303
Gene Namelipase, member O2
SynonymsGm8981
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33719670-33769142 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33730857 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 252 (C252*)
Ref Sequence ENSEMBL: ENSMUSP00000118907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000147153]
Predicted Effect probably benign
Transcript: ENSMUST00000025694
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147153
AA Change: C252*
SMART Domains Protein: ENSMUSP00000118907
Gene: ENSMUSG00000087303
AA Change: C252*

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.4e-24 PFAM
Pfam:Abhydrolase_1 76 213 1.7e-15 PFAM
Pfam:Abhydrolase_5 76 370 1.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Lipo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lipo2 APN 19 33721024 missense probably benign 0.03
IGL01780:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL01868:Lipo2 APN 19 33730838 missense probably benign 0.00
IGL02291:Lipo2 APN 19 33745792 missense possibly damaging 0.80
IGL02350:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02357:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02560:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL03354:Lipo2 APN 19 33730870 missense probably benign 0.09
R0183:Lipo2 UTSW 19 33749551 splice site probably null
R0529:Lipo2 UTSW 19 33746935 missense probably benign 0.05
R0576:Lipo2 UTSW 19 33749424 missense probably benign 0.02
R0579:Lipo2 UTSW 19 33746898 missense probably damaging 0.99
R0594:Lipo2 UTSW 19 33746902 missense possibly damaging 0.95
R0621:Lipo2 UTSW 19 33730939 missense probably damaging 1.00
R2190:Lipo2 UTSW 19 33748569 missense probably damaging 1.00
R2413:Lipo2 UTSW 19 33751257 missense probably damaging 0.98
R4066:Lipo2 UTSW 19 33720859 missense probably benign 0.01
R4258:Lipo2 UTSW 19 33730928 missense possibly damaging 0.88
R4365:Lipo2 UTSW 19 33721708 missense probably damaging 1.00
R4491:Lipo2 UTSW 19 33721700 missense probably damaging 0.99
R4640:Lipo2 UTSW 19 33720837 missense probably benign 0.04
R4822:Lipo2 UTSW 19 33745751 missense probably benign 0.01
R4872:Lipo2 UTSW 19 33749514 missense probably benign 0.00
R5004:Lipo2 UTSW 19 33721676 critical splice donor site probably null
R5112:Lipo2 UTSW 19 33748465 missense probably benign 0.00
R5440:Lipo2 UTSW 19 33720858 missense probably benign 0.39
R5737:Lipo2 UTSW 19 33721696 missense probably damaging 1.00
R6209:Lipo2 UTSW 19 33749452 missense probably damaging 1.00
R6868:Lipo2 UTSW 19 33748462 missense possibly damaging 0.86
R6893:Lipo2 UTSW 19 33721007 nonsense probably null
R7176:Lipo2 UTSW 19 33745807 missense possibly damaging 0.71
R7853:Lipo2 UTSW 19 33759944 start gained probably benign
R8092:Lipo2 UTSW 19 33749480 missense probably benign 0.00
R8101:Lipo2 UTSW 19 33720994 missense possibly damaging 0.79
R8464:Lipo2 UTSW 19 33748623 missense probably benign 0.02
X0052:Lipo2 UTSW 19 33720945 missense probably damaging 1.00
Z1088:Lipo2 UTSW 19 33721685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAGCAacaccacacacacacac -3'
(R):5'- ACAGCCTGCTATGCAGTTTTGAGAA -3'

Sequencing Primer
(F):5'- ccacacacacacacacacac -3'
(R):5'- CAGCAGCACATAGTAGTTTTGTC -3'
Posted On2014-01-05