Incidental Mutation 'R1027:Rab33b'
ID96832
Institutional Source Beutler Lab
Gene Symbol Rab33b
Ensembl Gene ENSMUSG00000027739
Gene NameRAB33B, member RAS oncogene family
Synonyms
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R1027 (G1)
Quality Score113
Status Validated
Chromosome3
Chromosomal Location51483920-51496232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51484455 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 42 (S42P)
Ref Sequence ENSEMBL: ENSMUSP00000142215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054387] [ENSMUST00000192172]
Predicted Effect probably damaging
Transcript: ENSMUST00000054387
AA Change: S42P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063054
Gene: ENSMUSG00000027739
AA Change: S42P

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
RAB 34 202 1.94e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192172
AA Change: S42P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142215
Gene: ENSMUSG00000027739
AA Change: S42P

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
Pfam:Ras 35 65 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195715
Meta Mutation Damage Score 0.7905 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the Rab GTPase family, whose members function in vesicle transport during protein secretion and endocytosis. Rab GTPases are active, membrane-associated proteins that recruit effector proteins in the GTP-bound state and inactive cytosolic proteins when in a GDP-bound state. The protein encoded by this gene is ubiquitously expressed and has been implicated in Golgi to endoplasmic reticulum cycling of Golgi enzymes. In addition, this protein regulates Golgi homeostasis and coordinates intra-Golgi retrograde trafficking. Allelic variants in this gene have been associated with Dyggve-Melchior-Clausen syndrome and Smith-McCort dysplasia 2, which are autosomal recessive spondyloepimetaphyseal dysplasias characterized by skeletal abnormalities. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Rab33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Rab33b APN 3 51484524 missense probably damaging 1.00
R0012:Rab33b UTSW 3 51484316 start gained probably benign
R0690:Rab33b UTSW 3 51493417 missense probably damaging 1.00
R3151:Rab33b UTSW 3 51493648 missense possibly damaging 0.83
R5259:Rab33b UTSW 3 51484612 unclassified probably benign
R5387:Rab33b UTSW 3 51493455 missense probably damaging 1.00
R5650:Rab33b UTSW 3 51493416 missense probably damaging 1.00
R5997:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R6318:Rab33b UTSW 3 51493405 missense probably damaging 0.99
R6640:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
Z1177:Rab33b UTSW 3 51484334 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- ACGCATCTTTCCAGGTACACCG -3'
(R):5'- TGGAGGAACAATGCCTCAGAAGTTTG -3'

Sequencing Primer
(F):5'- TTTGTCACTGCTAGGGAGC -3'
(R):5'- caatgCCTCAGAAGTTTGATAGATAC -3'
Posted On2014-01-05