Mutagenetix > Incidental Mutation

Incidental Mutation 'R1027:Mtor'

96848

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

MMRRC Submission

039129-MU

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148539999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 2079 (M2079V)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: M2079V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: M2079V

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129715

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158456

Meta Mutation Damage Score

0.0742

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 89.0%

Validation Efficiency

94% (31/33)

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	G	T	17: 33,543,763	R572L	probably benign	Het
Adamts16	A	T	13: 70,767,802	V838E	probably damaging	Het
Arfgef3	T	C	10: 18,591,375	R2026G	probably benign	Het
Arl16	G	A	11: 120,465,696	A159V	probably benign	Het
Astn1	G	T	1: 158,580,279	R602L	probably damaging	Het
Dennd1b	T	C	1: 139,041,962	V72A	probably damaging	Het
Filip1l	A	G	16: 57,569,688	E213G	probably benign	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gm4076	T	C	13: 85,127,389		noncoding transcript	Het
Herc1	T	C	9: 66,455,968	V2691A	probably benign	Het
Hid1	A	C	11: 115,355,425	F340V	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kif16b	T	C	2: 142,854,538		probably benign	Het
Map9	A	T	3: 82,377,094	D325V	probably damaging	Het
Nop14	A	G	5: 34,644,004	S608P	probably damaging	Het
Olfr486	A	T	7: 108,172,141	V201D	probably damaging	Het
Pcm1	T	C	8: 41,293,445		probably benign	Het
Pigs	T	C	11: 78,336,825	S272P	probably damaging	Het
Plekhh1	T	C	12: 79,054,482		probably benign	Het
Prkdc	A	G	16: 15,650,712	D129G	possibly damaging	Het
Rab33b	T	C	3: 51,484,455	S42P	probably damaging	Het
Rnf214	C	T	9: 45,899,889	V159I	probably benign	Het
Sel1l3	A	T	5: 53,145,478	M683K	possibly damaging	Het
Sntb2	A	G	8: 106,991,571	K304E	probably benign	Het
Svep1	C	A	4: 58,094,084	S1518I	possibly damaging	Het
Tg	T	C	15: 66,672,409	S76P	possibly damaging	Het
Ttn	A	G	2: 76,867,433		probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Brushes	UTSW	4	148463748	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	splice site	probably null
Erg	UTSW	4	148545596	missense	probably damaging	1.00
Lindor	UTSW	4	148454646	missense	probably damaging	1.00
motor	UTSW	4	148491360	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148454816	makesense	probably null
Vigor	UTSW	4	148538899	missense	probably damaging	1.00
Vim	UTSW	4	148525803	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148526046	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4942:Mtor	UTSW	4	148472142	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	splice site	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148538276	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148538547	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7737:Mtor	UTSW	4	148538738	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148454646	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148546399	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148525803	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148468287	missense	probably benign
R8928:Mtor	UTSW	4	148538899	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148463748	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148552741	missense	probably benign
R9284:Mtor	UTSW	4	148459080	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148469377	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148514940	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148538319	nonsense	probably null
R9465:Mtor	UTSW	4	148540382	missense	possibly damaging	0.92
R9492:Mtor	UTSW	4	148484344	missense	probably damaging	1.00
R9499:Mtor	UTSW	4	148514940	missense	probably damaging	1.00
R9516:Mtor	UTSW	4	148484646	missense	probably benign	0.23
R9600:Mtor	UTSW	4	148547635	missense	possibly damaging	0.82
R9622:Mtor	UTSW	4	148483712	missense	probably damaging	0.99
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148550125	missense	probably benign	0.08
Z1176:Mtor	UTSW	4	148550130	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CAAGCCCTCGATCACTCTTGAAACG -3'
(R):5'- ATGCACAGATGAACCCAGGATGCC -3'

Sequencing Primer
(F):5'- CTCGATCACTCTTGAAACGTATTG -3'
(R):5'- TTGACGTTCCCCGACTTCAT -3'

Posted On

2014-01-05