Incidental Mutation 'R1027:Nop14'
ID96852
Institutional Source Beutler Lab
Gene Symbol Nop14
Ensembl Gene ENSMUSG00000036693
Gene NameNOP14 nucleolar protein
SynonymsNol14, 2610033H07Rik
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1027 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34638536-34660148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34644004 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 608 (S608P)
Ref Sequence ENSEMBL: ENSMUSP00000038382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041364
AA Change: S608P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693
AA Change: S608P

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152393
Predicted Effect unknown
Transcript: ENSMUST00000201897
AA Change: S86P
Meta Mutation Damage Score 0.9221 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Nop14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Nop14 APN 5 34641313 unclassified probably benign
IGL00985:Nop14 APN 5 34644789 missense probably damaging 0.98
IGL01626:Nop14 APN 5 34649345 nonsense probably null
IGL02676:Nop14 APN 5 34639221 missense probably damaging 0.97
IGL03189:Nop14 APN 5 34650628 unclassified probably benign
IGL03047:Nop14 UTSW 5 34660014 missense possibly damaging 0.93
R0025:Nop14 UTSW 5 34643953 missense probably benign 0.08
R0831:Nop14 UTSW 5 34650520 missense possibly damaging 0.70
R1252:Nop14 UTSW 5 34650555 missense probably benign
R1616:Nop14 UTSW 5 34650413 missense possibly damaging 0.46
R1845:Nop14 UTSW 5 34650328 missense possibly damaging 0.82
R2032:Nop14 UTSW 5 34659939 missense possibly damaging 0.65
R3693:Nop14 UTSW 5 34654438 missense probably damaging 0.98
R4033:Nop14 UTSW 5 34650517 missense probably benign
R4168:Nop14 UTSW 5 34656744 missense probably damaging 0.99
R4172:Nop14 UTSW 5 34650607 missense probably damaging 0.99
R4618:Nop14 UTSW 5 34639218 missense probably damaging 1.00
R4936:Nop14 UTSW 5 34652393 missense probably damaging 1.00
R6067:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6075:Nop14 UTSW 5 34659891 missense probably damaging 1.00
R6078:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6284:Nop14 UTSW 5 34641491 splice site probably null
R7295:Nop14 UTSW 5 34639032 missense probably damaging 0.99
R7585:Nop14 UTSW 5 34644780 missense probably damaging 1.00
R7626:Nop14 UTSW 5 34651791 missense probably damaging 0.99
R7954:Nop14 UTSW 5 34650385 missense probably benign
R8079:Nop14 UTSW 5 34654461 missense probably damaging 1.00
R8428:Nop14 UTSW 5 34641440 missense probably damaging 0.99
R8850:Nop14 UTSW 5 34660008 missense probably benign 0.05
U15987:Nop14 UTSW 5 34657951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGGTTCCTGGATTGCAGACTTC -3'
(R):5'- GCAGCCTTCATAGTCAGTAAGCCTC -3'

Sequencing Primer
(F):5'- CAGACTTCAGAGGTTGTCAATG -3'
(R):5'- AAGCCTCTTTATCAGAGTGCAGG -3'
Posted On2014-01-05