Mutagenetix > Incidental Mutation

Incidental Mutation 'R1027:Sel1l3'

96854

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

039129-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1027 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

53264425-53370794 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53302820 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 683 (M683K)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

AlphaFold

Q80TS8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031090
AA Change: M683K

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: M683K

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196435

Meta Mutation Damage Score

0.0895

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 89.0%

Validation Efficiency

94% (31/33)

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	G	T	17: 33,762,737 (GRCm39)	R572L	probably benign	Het
Adamts16	A	T	13: 70,915,921 (GRCm39)	V838E	probably damaging	Het
Arfgef3	T	C	10: 18,467,123 (GRCm39)	R2026G	probably benign	Het
Arl16	G	A	11: 120,356,522 (GRCm39)	A159V	probably benign	Het
Astn1	G	T	1: 158,407,849 (GRCm39)	R602L	probably damaging	Het
Dennd1b	T	C	1: 138,969,700 (GRCm39)	V72A	probably damaging	Het
Filip1l	A	G	16: 57,390,051 (GRCm39)	E213G	probably benign	Het
Gm10985	A	C	3: 53,752,674 (GRCm39)	Y19S	probably damaging	Het
Gm4076	T	C	13: 85,275,508 (GRCm39)		noncoding transcript	Het
Herc1	T	C	9: 66,363,250 (GRCm39)	V2691A	probably benign	Het
Hid1	A	C	11: 115,246,251 (GRCm39)	F340V	probably damaging	Het
Itga10	C	T	3: 96,559,054 (GRCm39)		probably benign	Het
Kif16b	T	C	2: 142,696,458 (GRCm39)		probably benign	Het
Map9	A	T	3: 82,284,401 (GRCm39)	D325V	probably damaging	Het
Mtor	A	G	4: 148,624,456 (GRCm39)	M2079V	probably benign	Het
Nop14	A	G	5: 34,801,348 (GRCm39)	S608P	probably damaging	Het
Or5p62	A	T	7: 107,771,348 (GRCm39)	V201D	probably damaging	Het
Pcm1	T	C	8: 41,746,482 (GRCm39)		probably benign	Het
Pigs	T	C	11: 78,227,651 (GRCm39)	S272P	probably damaging	Het
Plekhh1	T	C	12: 79,101,256 (GRCm39)		probably benign	Het
Prkdc	A	G	16: 15,468,576 (GRCm39)	D129G	possibly damaging	Het
Rab33b	T	C	3: 51,391,876 (GRCm39)	S42P	probably damaging	Het
Rnf214	C	T	9: 45,811,187 (GRCm39)	V159I	probably benign	Het
Sntb2	A	G	8: 107,718,203 (GRCm39)	K304E	probably benign	Het
Svep1	C	A	4: 58,094,084 (GRCm39)	S1518I	possibly damaging	Het
Tg	T	C	15: 66,544,258 (GRCm39)	S76P	possibly damaging	Het
Ttn	A	G	2: 76,697,777 (GRCm39)		probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 35,115,284 (GRCm39)		probably null	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53,273,675 (GRCm39)	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53,311,578 (GRCm39)	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53,357,510 (GRCm39)	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53,279,183 (GRCm39)	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53,357,485 (GRCm39)	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53,357,680 (GRCm39)	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53,302,835 (GRCm39)	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53,327,747 (GRCm39)	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53,297,141 (GRCm39)	splice site	probably benign
IGL02930:Sel1l3	APN	5	53,280,559 (GRCm39)	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53,311,585 (GRCm39)	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53,279,199 (GRCm39)	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53,295,244 (GRCm39)	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53,295,244 (GRCm39)	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53,295,244 (GRCm39)	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53,301,379 (GRCm39)	splice site	probably benign
R1117:Sel1l3	UTSW	5	53,329,949 (GRCm39)	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53,289,169 (GRCm39)	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53,289,169 (GRCm39)	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53,274,445 (GRCm39)	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53,274,445 (GRCm39)	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53,357,559 (GRCm39)	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53,357,559 (GRCm39)	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53,295,271 (GRCm39)	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53,302,887 (GRCm39)	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53,327,789 (GRCm39)	nonsense	probably null
R2872:Sel1l3	UTSW	5	53,295,225 (GRCm39)	nonsense	probably null
R2872:Sel1l3	UTSW	5	53,295,225 (GRCm39)	nonsense	probably null
R3434:Sel1l3	UTSW	5	53,274,432 (GRCm39)	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53,345,396 (GRCm39)	nonsense	probably null
R4074:Sel1l3	UTSW	5	53,311,629 (GRCm39)	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53,301,525 (GRCm39)	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53,289,175 (GRCm39)	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53,289,184 (GRCm39)	missense	probably damaging	1.00
R5000:Sel1l3	UTSW	5	53,357,776 (GRCm39)	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53,357,388 (GRCm39)	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53,343,351 (GRCm39)	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53,357,378 (GRCm39)	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53,357,644 (GRCm39)	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53,342,150 (GRCm39)	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53,357,531 (GRCm39)	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53,313,061 (GRCm39)	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53,297,202 (GRCm39)	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53,329,916 (GRCm39)	missense	probably benign	0.03
R7200:Sel1l3	UTSW	5	53,301,451 (GRCm39)	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53,273,704 (GRCm39)	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53,273,751 (GRCm39)	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53,274,462 (GRCm39)	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53,343,326 (GRCm39)	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53,280,504 (GRCm39)	splice site	probably null
R7741:Sel1l3	UTSW	5	53,357,593 (GRCm39)	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53,293,227 (GRCm39)	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53,301,406 (GRCm39)	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53,297,166 (GRCm39)	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53,345,296 (GRCm39)	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53,293,165 (GRCm39)	nonsense	probably null
R8788:Sel1l3	UTSW	5	53,332,148 (GRCm39)	nonsense	probably null
R8988:Sel1l3	UTSW	5	53,280,771 (GRCm39)	missense	probably damaging	0.96
R9111:Sel1l3	UTSW	5	53,279,213 (GRCm39)	splice site	probably benign
R9153:Sel1l3	UTSW	5	53,293,188 (GRCm39)	missense	probably benign	0.26
R9269:Sel1l3	UTSW	5	53,311,628 (GRCm39)	missense	probably damaging	1.00
R9399:Sel1l3	UTSW	5	53,265,486 (GRCm39)	missense	probably benign
R9455:Sel1l3	UTSW	5	53,289,157 (GRCm39)	missense	probably damaging	0.99
R9630:Sel1l3	UTSW	5	53,342,117 (GRCm39)	missense	possibly damaging	0.49
R9793:Sel1l3	UTSW	5	53,329,924 (GRCm39)	missense	probably benign	0.02
R9795:Sel1l3	UTSW	5	53,329,924 (GRCm39)	missense	probably benign	0.02
Z1088:Sel1l3	UTSW	5	53,273,538 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATACAGCAGCATCGCTTTAAGCCG -3'
(R):5'- ACGACACCAGGCAGACTTTTGAAC -3'

Sequencing Primer
(F):5'- ATCGCTTTAAGCCGCAGAG -3'
(R):5'- TATGCAGGACATGGTCCATC -3'

Posted On

2014-01-05