Incidental Mutation 'R1027:Sel1l3'
ID96854
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1027 (G1)
Quality Score171
Status Validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53145478 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 683 (M683K)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031090
AA Change: M683K

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: M683K

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196435
Meta Mutation Damage Score 0.0895 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7987:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATACAGCAGCATCGCTTTAAGCCG -3'
(R):5'- ACGACACCAGGCAGACTTTTGAAC -3'

Sequencing Primer
(F):5'- ATCGCTTTAAGCCGCAGAG -3'
(R):5'- TATGCAGGACATGGTCCATC -3'
Posted On2014-01-05