Incidental Mutation 'R1112:Zfp692'
ID96855
Institutional Source Beutler Lab
Gene Symbol Zfp692
Ensembl Gene ENSMUSG00000037243
Gene Namezinc finger protein 692
SynonymsZfp692-ps
MMRRC Submission 039185-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1112 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58307069-58314627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58311562 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 381 (L381P)
Ref Sequence ENSEMBL: ENSMUSP00000131896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000057836] [ENSMUST00000064786] [ENSMUST00000108829] [ENSMUST00000153510]
Predicted Effect probably damaging
Transcript: ENSMUST00000049353
AA Change: L381P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243
AA Change: L381P

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057836
SMART Domains Protein: ENSMUSP00000060088
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064786
SMART Domains Protein: ENSMUSP00000070567
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108829
SMART Domains Protein: ENSMUSP00000104457
Gene: ENSMUSG00000049755

DomainStartEndE-ValueType
ZnF_C2H2 15 37 4.17e-3 SMART
ZnF_C2H2 43 65 8.75e0 SMART
ZnF_C2H2 71 93 1.18e-2 SMART
ZnF_C2H2 100 123 1.76e-1 SMART
ZnF_C2H2 129 151 1.59e1 SMART
ZnF_C2H2 167 189 4.47e-3 SMART
ZnF_C2H2 202 224 9.58e-3 SMART
ZnF_C2H2 230 252 7.37e-4 SMART
ZnF_C2H2 258 280 3.16e-3 SMART
ZnF_C2H2 286 308 1.45e-2 SMART
ZnF_C2H2 314 336 4.01e-5 SMART
ZnF_C2H2 342 364 5.5e-3 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
ZnF_C2H2 398 420 6.67e-2 SMART
low complexity region 421 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153510
AA Change: L381P

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243
AA Change: L381P

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,713,572 N122D probably benign Het
Atrn A G 2: 130,999,161 D1161G probably benign Het
Bscl2 G C 19: 8,839,734 G9R possibly damaging Het
Clstn2 T C 9: 97,458,228 N697S possibly damaging Het
Ctnnd2 T C 15: 30,921,880 V884A probably damaging Het
Dusp10 A T 1: 184,036,900 Q21L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam172a A G 13: 77,761,886 Y40C probably damaging Het
Foxn1 A G 11: 78,371,030 F171S probably benign Het
Fxr2 A G 11: 69,652,248 S624G probably damaging Het
Gorasp2 C A 2: 70,690,814 P376Q probably benign Het
Gpr33 A G 12: 52,023,372 S295P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hap1 C T 11: 100,354,317 V23M probably damaging Het
Hsd3b5 C T 3: 98,630,077 R41Q probably benign Het
Kif1c T G 11: 70,724,815 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd A G 2: 91,143,599 C1447R probably damaging Het
Myef2 A C 2: 125,097,586 M426R probably damaging Het
Myh13 A T 11: 67,354,750 D1072V probably damaging Het
Olfr394 A C 11: 73,888,234 L46R probably damaging Het
Olfr586 C T 7: 103,122,404 D123N probably damaging Het
Orc4 A T 2: 48,933,572 N90K probably damaging Het
Padi4 C T 4: 140,758,116 S246N probably benign Het
Pcdhb22 A T 18: 37,519,768 T430S possibly damaging Het
Prkd3 T C 17: 78,966,408 D473G probably damaging Het
Scn4a T C 11: 106,320,466 Y1575C probably damaging Het
Serpinb6d A G 13: 33,669,135 Y170C probably damaging Het
Slc12a2 A T 18: 57,937,752 I1059L probably benign Het
Slc36a4 T A 9: 15,723,515 F118I possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srpr A G 9: 35,214,959 T483A probably benign Het
Sycp2 A T 2: 178,352,536 D1198E probably benign Het
Ubash3b T C 9: 41,028,116 N287D probably damaging Het
Uggt1 T C 1: 36,173,546 D905G possibly damaging Het
Other mutations in Zfp692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Zfp692 APN 11 58314029 missense possibly damaging 0.94
IGL00978:Zfp692 APN 11 58309998 missense possibly damaging 0.92
IGL01667:Zfp692 APN 11 58311553 missense probably damaging 1.00
IGL02209:Zfp692 APN 11 58313998 nonsense probably null
IGL02873:Zfp692 APN 11 58308939 missense probably damaging 1.00
R0255:Zfp692 UTSW 11 58310403 splice site probably benign
R0267:Zfp692 UTSW 11 58314314 missense possibly damaging 0.64
R0506:Zfp692 UTSW 11 58309055 nonsense probably null
R0554:Zfp692 UTSW 11 58314227 missense probably damaging 1.00
R0628:Zfp692 UTSW 11 58309623 missense probably damaging 1.00
R0712:Zfp692 UTSW 11 58314314 missense probably benign 0.00
R1493:Zfp692 UTSW 11 58314040 missense probably damaging 1.00
R1768:Zfp692 UTSW 11 58310176 splice site probably benign
R1853:Zfp692 UTSW 11 58309979 missense possibly damaging 0.69
R3551:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R3552:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R4281:Zfp692 UTSW 11 58314265 missense probably damaging 1.00
R4784:Zfp692 UTSW 11 58310171 missense probably null 0.12
R5150:Zfp692 UTSW 11 58307587 start codon destroyed probably null 0.77
R7035:Zfp692 UTSW 11 58309442 critical splice donor site probably null
R7343:Zfp692 UTSW 11 58311505 missense probably damaging 1.00
R7896:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R8071:Zfp692 UTSW 11 58307734 missense probably damaging 0.96
R8163:Zfp692 UTSW 11 58310373 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATTGCAACGATGGTGTGCAAGG -3'
(R):5'- GTAGGCATTTCACTAGGGTCAGGC -3'

Sequencing Primer
(F):5'- TGGATGAGAAACCCGCCTG -3'
(R):5'- TCACTAGGGTCAGGCTACCAAG -3'
Posted On2014-01-05