Mutagenetix > Incidental Mutation

Incidental Mutation 'R1027:Pcm1'

96870

Institutional Source

Beutler Lab

Gene Symbol

Pcm1

Ensembl Gene

ENSMUSG00000031592

Gene Name

pericentriolar material 1

Synonyms

9430077F19Rik, 2600002H09Rik, C030044G17Rik

MMRRC Submission

039129-MU

Accession Numbers

Genbank: NM_023662; MGI: 1277958

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1027 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41239752-41332344 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 41293445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]

AlphaFold

Q9R0L6

Predicted Effect

probably benign
Transcript: ENSMUST00000045218

SMART Domains

Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592

Domain	Start	End	E-Value	Type
coiled coil region	218	238	N/A	INTRINSIC
coiled coil region	270	301	N/A	INTRINSIC
coiled coil region	399	426	N/A	INTRINSIC
coiled coil region	492	520	N/A	INTRINSIC
low complexity region	527	548	N/A	INTRINSIC
low complexity region	622	647	N/A	INTRINSIC
coiled coil region	652	683	N/A	INTRINSIC
coiled coil region	724	772	N/A	INTRINSIC
coiled coil region	822	856	N/A	INTRINSIC
coiled coil region	988	1017	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
Pfam:PCM1_C	1369	1999	3.6e-295	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211247

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 89.0%

Validation Efficiency

94% (31/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts10	G	T	17: 33,543,763	R572L	probably benign	Het
Adamts16	A	T	13: 70,767,802	V838E	probably damaging	Het
Arfgef3	T	C	10: 18,591,375	R2026G	probably benign	Het
Arl16	G	A	11: 120,465,696	A159V	probably benign	Het
Astn1	G	T	1: 158,580,279	R602L	probably damaging	Het
Dennd1b	T	C	1: 139,041,962	V72A	probably damaging	Het
Filip1l	A	G	16: 57,569,688	E213G	probably benign	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gm4076	T	C	13: 85,127,389		noncoding transcript	Het
Herc1	T	C	9: 66,455,968	V2691A	probably benign	Het
Hid1	A	C	11: 115,355,425	F340V	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kif16b	T	C	2: 142,854,538		probably benign	Het
Map9	A	T	3: 82,377,094	D325V	probably damaging	Het
Mtor	A	G	4: 148,539,999	M2079V	probably benign	Het
Nop14	A	G	5: 34,644,004	S608P	probably damaging	Het
Olfr486	A	T	7: 108,172,141	V201D	probably damaging	Het
Pigs	T	C	11: 78,336,825	S272P	probably damaging	Het
Plekhh1	T	C	12: 79,054,482		probably benign	Het
Prkdc	A	G	16: 15,650,712	D129G	possibly damaging	Het
Rab33b	T	C	3: 51,484,455	S42P	probably damaging	Het
Rnf214	C	T	9: 45,899,889	V159I	probably benign	Het
Sel1l3	A	T	5: 53,145,478	M683K	possibly damaging	Het
Sntb2	A	G	8: 106,991,571	K304E	probably benign	Het
Svep1	C	A	4: 58,094,084	S1518I	possibly damaging	Het
Tg	T	C	15: 66,672,409	S76P	possibly damaging	Het
Ttn	A	G	2: 76,867,433		probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het

Other mutations in Pcm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Pcm1	APN	8	41274277	missense	probably damaging	1.00
IGL00852:Pcm1	APN	8	41287821	missense	probably damaging	1.00
IGL00896:Pcm1	APN	8	41276123	missense	possibly damaging	0.70
IGL00927:Pcm1	APN	8	41287881	missense	probably damaging	1.00
IGL01085:Pcm1	APN	8	41309603	missense	probably damaging	1.00
IGL01684:Pcm1	APN	8	41257923	missense	probably benign	0.00
IGL01888:Pcm1	APN	8	41257956	missense	probably damaging	0.98
IGL02349:Pcm1	APN	8	41288155	critical splice donor site	probably null
IGL02562:Pcm1	APN	8	41325368	missense	probably damaging	1.00
IGL02807:Pcm1	APN	8	41330882	missense	probably damaging	1.00
IGL03081:Pcm1	APN	8	41275060	missense	probably damaging	1.00
R0090_Pcm1_148	UTSW	8	41256041	missense	probably damaging	0.99
R1534_pcm1_826	UTSW	8	41287701	missense	probably benign
R8169_pcm1_970	UTSW	8	41310116	missense	possibly damaging	0.58
shaved	UTSW	8	41288156	critical splice donor site	probably null
D3080:Pcm1	UTSW	8	41275939	missense	probably damaging	1.00
P0045:Pcm1	UTSW	8	41288097	missense	probably damaging	0.99
R0090:Pcm1	UTSW	8	41256041	missense	probably damaging	0.99
R0109:Pcm1	UTSW	8	41257937	missense	possibly damaging	0.88
R0373:Pcm1	UTSW	8	41276111	nonsense	probably null
R0386:Pcm1	UTSW	8	41316023	missense	probably damaging	1.00
R0452:Pcm1	UTSW	8	41325905	missense	probably benign	0.25
R0498:Pcm1	UTSW	8	41293769	missense	probably benign	0.01
R0528:Pcm1	UTSW	8	41315930	missense	probably damaging	1.00
R0587:Pcm1	UTSW	8	41286051	missense	probably damaging	0.99
R0635:Pcm1	UTSW	8	41267179	splice site	probably benign
R0725:Pcm1	UTSW	8	41287811	missense	probably damaging	1.00
R0762:Pcm1	UTSW	8	41261020	missense	probably damaging	1.00
R0848:Pcm1	UTSW	8	41282683	missense	probably damaging	1.00
R1056:Pcm1	UTSW	8	41321900	missense	probably damaging	1.00
R1534:Pcm1	UTSW	8	41287701	missense	probably benign
R1566:Pcm1	UTSW	8	41290773	missense	probably damaging	1.00
R1595:Pcm1	UTSW	8	41309635	missense	probably damaging	1.00
R1719:Pcm1	UTSW	8	41313359	missense	possibly damaging	0.62
R1816:Pcm1	UTSW	8	41309537	missense	probably damaging	0.99
R2177:Pcm1	UTSW	8	41275965	missense	probably benign
R2495:Pcm1	UTSW	8	41293579	missense	probably benign
R3737:Pcm1	UTSW	8	41261043	nonsense	probably null
R3747:Pcm1	UTSW	8	41332004	missense	probably benign	0.44
R3763:Pcm1	UTSW	8	41280077	missense	probably damaging	1.00
R3764:Pcm1	UTSW	8	41330882	missense	probably damaging	1.00
R3798:Pcm1	UTSW	8	41258014	missense	possibly damaging	0.66
R3968:Pcm1	UTSW	8	41325830	missense	probably damaging	1.00
R4760:Pcm1	UTSW	8	41287738	missense	probably damaging	0.99
R4798:Pcm1	UTSW	8	41293678	missense	probably damaging	1.00
R5062:Pcm1	UTSW	8	41259260	missense	probably damaging	0.99
R5221:Pcm1	UTSW	8	41288156	critical splice donor site	probably null
R5250:Pcm1	UTSW	8	41312205	missense	probably damaging	0.99
R5466:Pcm1	UTSW	8	41272462	critical splice donor site	probably null
R5470:Pcm1	UTSW	8	41287683	missense	probably damaging	1.00
R5958:Pcm1	UTSW	8	41328979	missense	probably damaging	1.00
R6043:Pcm1	UTSW	8	41328778	missense	possibly damaging	0.54
R6179:Pcm1	UTSW	8	41283632	missense	probably damaging	0.99
R6186:Pcm1	UTSW	8	41293793	missense	probably benign	0.23
R6227:Pcm1	UTSW	8	41330825	missense	probably damaging	0.99
R6368:Pcm1	UTSW	8	41293544	missense	probably benign	0.09
R6438:Pcm1	UTSW	8	41325381	missense	possibly damaging	0.94
R6459:Pcm1	UTSW	8	41261036	missense	probably damaging	1.00
R7399:Pcm1	UTSW	8	41293510	missense	probably benign	0.11
R7401:Pcm1	UTSW	8	41309531	missense	probably damaging	1.00
R7478:Pcm1	UTSW	8	41261373	missense	probably benign	0.17
R7570:Pcm1	UTSW	8	41267344	missense	possibly damaging	0.64
R7648:Pcm1	UTSW	8	41275699	missense	probably damaging	0.99
R7773:Pcm1	UTSW	8	41309573	nonsense	probably null
R7779:Pcm1	UTSW	8	41329024	missense	probably damaging	1.00
R7842:Pcm1	UTSW	8	41327584	missense	possibly damaging	0.54
R7863:Pcm1	UTSW	8	41261126	missense	probably damaging	0.99
R8169:Pcm1	UTSW	8	41310116	missense	possibly damaging	0.58
R8210:Pcm1	UTSW	8	41313937	missense	probably damaging	1.00
R8303:Pcm1	UTSW	8	41283721	missense	probably damaging	1.00
R8397:Pcm1	UTSW	8	41283579	missense	probably damaging	1.00
R8489:Pcm1	UTSW	8	41313400	missense	probably benign	0.19
R8519:Pcm1	UTSW	8	41275939	missense	probably damaging	1.00
R9136:Pcm1	UTSW	8	41279788	missense	probably benign	0.19
R9245:Pcm1	UTSW	8	41279840	missense	probably damaging	0.99
R9263:Pcm1	UTSW	8	41279753	missense	probably benign	0.00
R9406:Pcm1	UTSW	8	41275685	missense	probably damaging	0.99
R9412:Pcm1	UTSW	8	41287751	missense	probably damaging	1.00
R9541:Pcm1	UTSW	8	41327579	missense	probably benign	0.09
R9698:Pcm1	UTSW	8	41270504	missense	possibly damaging	0.95
R9716:Pcm1	UTSW	8	41275131	missense	probably damaging	0.98
R9747:Pcm1	UTSW	8	41304098	missense	probably benign	0.00
R9781:Pcm1	UTSW	8	41267361	missense	probably damaging	0.99
X0025:Pcm1	UTSW	8	41330642	missense	probably damaging	1.00
Z1177:Pcm1	UTSW	8	41274171	missense	possibly damaging	0.94
Z1177:Pcm1	UTSW	8	41287744	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACACTTGCTGGGCTCTCTGATTAAAA -3'
(R):5'- GAAGCAGCTTTCTACAATGCCTGTAGAT -3'

Sequencing Primer
(F):5'- GTGAAAGTGTTTTCCTAGCCTGTT -3'
(R):5'- GATCAGGCATACTGCTAAAGC -3'

Posted On

2014-01-05