Incidental Mutation 'R1027:Pcm1'
ID96870
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission 039129-MU
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1027 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 41293445 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably benign
Transcript: ENSMUST00000045218
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211247
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
R0090_Pcm1_148 UTSW 8 41256041 missense probably damaging 0.99
R1534_Pcm1_826 UTSW 8 41287701 missense probably benign
R8169_pcm1_970 UTSW 8 41310116 missense possibly damaging 0.58
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41309537 missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3763:Pcm1 UTSW 8 41280077 missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41325830 missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41293544 missense probably benign 0.09
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41261373 missense probably benign 0.17
R7570:Pcm1 UTSW 8 41267344 missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41275699 missense probably damaging 0.99
R7773:Pcm1 UTSW 8 41309573 nonsense probably null
R7779:Pcm1 UTSW 8 41329024 missense probably damaging 1.00
R7842:Pcm1 UTSW 8 41327584 missense possibly damaging 0.54
R7863:Pcm1 UTSW 8 41261126 missense probably damaging 0.99
R8169:Pcm1 UTSW 8 41310116 missense possibly damaging 0.58
R8210:Pcm1 UTSW 8 41313937 missense probably damaging 1.00
R8303:Pcm1 UTSW 8 41283721 missense probably damaging 1.00
R8397:Pcm1 UTSW 8 41283579 missense probably damaging 1.00
R8489:Pcm1 UTSW 8 41313400 missense probably benign 0.19
R8519:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Z1177:Pcm1 UTSW 8 41274171 missense possibly damaging 0.94
Z1177:Pcm1 UTSW 8 41287744 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACACTTGCTGGGCTCTCTGATTAAAA -3'
(R):5'- GAAGCAGCTTTCTACAATGCCTGTAGAT -3'

Sequencing Primer
(F):5'- GTGAAAGTGTTTTCCTAGCCTGTT -3'
(R):5'- GATCAGGCATACTGCTAAAGC -3'
Posted On2014-01-05