Incidental Mutation 'R1027:Rnf214'
ID96878
Institutional Source Beutler Lab
Gene Symbol Rnf214
Ensembl Gene ENSMUSG00000042790
Gene Namering finger protein 214
SynonymsD130054N24Rik
MMRRC Submission 039129-MU
Accession Numbers

Ncbi RefSeq: NM_178709.4; MGI:2444451

Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R1027 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45863425-45906911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45899889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 159 (V159I)
Ref Sequence ENSEMBL: ENSMUSP00000149889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058720] [ENSMUST00000160699] [ENSMUST00000160811] [ENSMUST00000161187] [ENSMUST00000161203] [ENSMUST00000162369] [ENSMUST00000162699] [ENSMUST00000213659]
Predicted Effect probably benign
Transcript: ENSMUST00000058720
AA Change: V159I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060941
Gene: ENSMUSG00000042790
AA Change: V159I

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160469
Predicted Effect probably benign
Transcript: ENSMUST00000160699
AA Change: V159I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123754
Gene: ENSMUSG00000042790
AA Change: V159I

DomainStartEndE-ValueType
low complexity region 187 196 N/A INTRINSIC
SCOP:d1eq1a_ 235 382 3e-5 SMART
low complexity region 428 444 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
RING 620 664 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160811
Predicted Effect probably benign
Transcript: ENSMUST00000161187
SMART Domains Protein: ENSMUSP00000124296
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
coiled coil region 65 224 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 465 509 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161203
SMART Domains Protein: ENSMUSP00000123995
Gene: ENSMUSG00000042790

DomainStartEndE-ValueType
SCOP:d1eq1a_ 80 227 2e-5 SMART
low complexity region 273 289 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
RING 500 544 3.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162369
AA Change: V159I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000162699
Predicted Effect probably benign
Transcript: ENSMUST00000213659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215005
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
Allele List at MGI

All alleles(12) : Targeted(3) Gene trapped(9)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Rnf214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Rnf214 APN 9 45899786 missense probably damaging 1.00
IGL02314:Rnf214 APN 9 45899807 missense probably benign 0.00
IGL02604:Rnf214 APN 9 45869543 missense probably damaging 1.00
IGL02739:Rnf214 APN 9 45869474 missense probably benign
Contorted UTSW 9 45868046 nonsense probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0067:Rnf214 UTSW 9 45867498 critical splice donor site probably null
R0091:Rnf214 UTSW 9 45898493 critical splice acceptor site probably null
R0375:Rnf214 UTSW 9 45899823 missense probably damaging 0.97
R1850:Rnf214 UTSW 9 45869448 splice site probably benign
R2424:Rnf214 UTSW 9 45899798 missense probably damaging 0.99
R3751:Rnf214 UTSW 9 45867603 missense probably damaging 1.00
R3772:Rnf214 UTSW 9 45866634 missense possibly damaging 0.83
R4164:Rnf214 UTSW 9 45871912 missense probably damaging 0.99
R4969:Rnf214 UTSW 9 45896188 missense probably damaging 1.00
R5032:Rnf214 UTSW 9 45899744 critical splice donor site probably null
R5647:Rnf214 UTSW 9 45868046 nonsense probably null
R5849:Rnf214 UTSW 9 45868088 missense probably damaging 1.00
R5894:Rnf214 UTSW 9 45866618 missense probably damaging 1.00
R6296:Rnf214 UTSW 9 45867821 missense probably benign 0.05
R6467:Rnf214 UTSW 9 45867588 missense probably damaging 0.97
R6533:Rnf214 UTSW 9 45900063 missense probably benign 0.00
R6621:Rnf214 UTSW 9 45896170 missense probably damaging 1.00
R6801:Rnf214 UTSW 9 45896105 missense probably damaging 1.00
R6940:Rnf214 UTSW 9 45890898 missense probably damaging 0.99
R7398:Rnf214 UTSW 9 45867547 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGACACAATGCAGTTCTCTACCACC -3'
(R):5'- ACAGCCCTTTGTCTTTCTGGCAATG -3'

Sequencing Primer
(F):5'- ATGCAGTTCTCTACCACCTAAATGG -3'
(R):5'- CTGGCAATGGGTCTCAGTC -3'
Posted On2014-01-05