Incidental Mutation 'R1027:Plekhh1'
ID96888
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1027 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79029163-79081655 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 79054482 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000217954] [ENSMUST00000219956]
Predicted Effect probably benign
Transcript: ENSMUST00000039928
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217954
Predicted Effect probably benign
Transcript: ENSMUST00000219956
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Adamts16 A T 13: 70,767,802 V838E probably damaging Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0626:Plekhh1 UTSW 12 79040585 nonsense probably null
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R2345:Plekhh1 UTSW 12 79053647 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4039:Plekhh1 UTSW 12 79055183 missense probably benign 0.01
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
R7058:Plekhh1 UTSW 12 79075430 missense probably damaging 1.00
R7103:Plekhh1 UTSW 12 79066655 missense probably benign 0.01
R7120:Plekhh1 UTSW 12 79070939 missense probably benign 0.03
R7134:Plekhh1 UTSW 12 79062616 missense probably benign 0.00
R7209:Plekhh1 UTSW 12 79050376 missense probably benign 0.04
R7403:Plekhh1 UTSW 12 79040577 nonsense probably null
R7405:Plekhh1 UTSW 12 79055047 missense probably benign 0.00
R7449:Plekhh1 UTSW 12 79079552 missense probably benign 0.00
R7594:Plekhh1 UTSW 12 79076503 missense possibly damaging 0.89
R7648:Plekhh1 UTSW 12 79055131 missense probably benign 0.20
R7756:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R7758:Plekhh1 UTSW 12 79070804 missense probably benign 0.15
R8033:Plekhh1 UTSW 12 79070936 missense probably benign 0.23
R8153:Plekhh1 UTSW 12 79079038 missense probably benign 0.00
R8243:Plekhh1 UTSW 12 79079069 missense probably benign
R8728:Plekhh1 UTSW 12 79069088 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAGGGGTTGTGAAATGATACCGC -3'
(R):5'- AGGATGGACCATGCTGAAACGC -3'

Sequencing Primer
(F):5'- GTTGTGAAATGATACCGCATACG -3'
(R):5'- GCCACCTTCAAAATCTGGGTATG -3'
Posted On2014-01-05