Incidental Mutation 'R1027:Adamts16'
ID96892
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 039129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1027 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70767802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 838 (V838E)
Ref Sequence ENSEMBL: ENSMUSP00000105316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
Predicted Effect probably damaging
Transcript: ENSMUST00000080145
AA Change: V838E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: V838E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109694
AA Change: V838E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: V838E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Meta Mutation Damage Score 0.4247 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 89.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 G T 17: 33,543,763 R572L probably benign Het
Arfgef3 T C 10: 18,591,375 R2026G probably benign Het
Arl16 G A 11: 120,465,696 A159V probably benign Het
Astn1 G T 1: 158,580,279 R602L probably damaging Het
Dennd1b T C 1: 139,041,962 V72A probably damaging Het
Filip1l A G 16: 57,569,688 E213G probably benign Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm4076 T C 13: 85,127,389 noncoding transcript Het
Herc1 T C 9: 66,455,968 V2691A probably benign Het
Hid1 A C 11: 115,355,425 F340V probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif16b T C 2: 142,854,538 probably benign Het
Map9 A T 3: 82,377,094 D325V probably damaging Het
Mtor A G 4: 148,539,999 M2079V probably benign Het
Nop14 A G 5: 34,644,004 S608P probably damaging Het
Olfr486 A T 7: 108,172,141 V201D probably damaging Het
Pcm1 T C 8: 41,293,445 probably benign Het
Pigs T C 11: 78,336,825 S272P probably damaging Het
Plekhh1 T C 12: 79,054,482 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rab33b T C 3: 51,484,455 S42P probably damaging Het
Rnf214 C T 9: 45,899,889 V159I probably benign Het
Sel1l3 A T 5: 53,145,478 M683K possibly damaging Het
Sntb2 A G 8: 106,991,571 K304E probably benign Het
Svep1 C A 4: 58,094,084 S1518I possibly damaging Het
Tg T C 15: 66,672,409 S76P possibly damaging Het
Ttn A G 2: 76,867,433 probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70738955 missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 splice site probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70767992 missense probably benign 0.01
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5667:Adamts16 UTSW 13 70836375 nonsense probably null
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 splice site probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
R7509:Adamts16 UTSW 13 70787164 missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70730115 missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70836146 missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70738582 missense probably benign
R8231:Adamts16 UTSW 13 70777480 missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70793098 missense probably damaging 1.00
R8470:Adamts16 UTSW 13 70836377 missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70738675 missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70836334 missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70793188 missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70761773 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTACAGGCTCCTAAATCAAGCAAGG -3'
(R):5'- CCGTTCGGAACATAGACTCTCACATC -3'

Sequencing Primer
(F):5'- GCTCCTAAATCAAGCAAGGAAAGAC -3'
(R):5'- CTCTCACATCCAATTGTGGAGAAG -3'
Posted On2014-01-05