Mutagenetix > Incidental Mutations

Incidental Mutation 'R1113:Sned1'

96914

Institutional Source

Beutler Lab

Gene Symbol

Sned1

Ensembl Gene

ENSMUSG00000047793

Gene Name

sushi, nidogen and EGF-like domains 1

Synonyms

6720455I24Rik, D430044C15Rik, Snep

MMRRC Submission

039186-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R1113 (G1)

Quality Score

183

Status

Not validated

Chromosome

Chromosomal Location

93235841-93301065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 93281654 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 830 (V830M)

Ref Sequence

ENSEMBL: ENSMUSP00000050832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062202]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062202
AA Change: V830M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: V830M

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
NIDO	103	260	2.98e-54	SMART
EGF	271	309	3.79e-6	SMART
EGF_CA	311	347	2.42e-13	SMART
EGF	352	385	1.02e-6	SMART
EGF_CA	387	423	1.91e-11	SMART
EGF	432	465	2.96e-8	SMART
EGF	471	500	6.02e0	SMART
EGF	544	577	3.54e-6	SMART
EGF	583	616	6.06e-5	SMART
EGF_CA	619	655	2.33e-6	SMART
EGF	660	693	1.77e-6	SMART
CCP	698	751	2.5e-11	SMART
EGF_CA	753	789	1.66e-11	SMART
EGF_CA	791	827	1.38e-8	SMART
EGF_CA	829	865	1.92e-7	SMART
EGF	870	903	2.35e-2	SMART
FN3	906	991	1.7e-4	SMART
FN3	1005	1084	1.38e-4	SMART
FN3	1104	1185	1.6e-9	SMART
EGF	1309	1342	6.16e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000163688
AA Change: V39M

SMART Domains

Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: V39M

Domain	Start	End	E-Value	Type
EGF_CA	1	37	6.7e-7	SMART
EGF_CA	39	75	1.92e-7	SMART
EGF	80	113	2.35e-2	SMART
FN3	116	201	1.7e-4	SMART
FN3	215	294	1.38e-4	SMART
FN3	314	395	1.6e-9	SMART
EGF	487	520	6.16e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165843

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172289

Meta Mutation Damage Score

0.1152

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 93.0%
20x: 82.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	G	A	19: 9,005,620	E1423K	probably benign	Het
Angpt2	C	T	8: 18,692,118	W474*	probably null	Het
Cln6	A	G	9: 62,850,861	T301A	probably damaging	Het
D730048I06Rik	T	C	9: 35,789,089	T67A	probably benign	Het
G6pc2	A	T	2: 69,220,226	D65V	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Map3k6	T	C	4: 133,245,815	S395P	probably damaging	Het
Myo6	G	A	9: 80,245,714	V210I	probably damaging	Het
Otoa	C	A	7: 121,125,443	C448*	probably null	Het
Prkcg	G	C	7: 3,329,106	K525N	probably damaging	Het
Pros1	G	A	16: 62,913,865	D345N	probably damaging	Het
Prss47	T	C	13: 65,051,816	H83R	probably benign	Het
Tekt2	A	T	4: 126,324,918	L14H	probably damaging	Het
Tnpo2	T	C	8: 85,055,353	F857S	probably damaging	Het
Try4	G	T	6: 41,305,374	Q209H	possibly damaging	Het
Wdfy4	G	A	14: 32,971,738	S2710L	possibly damaging	Het

Other mutations in Sned1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Sned1	APN	1	93274169	splice site	probably benign
IGL00955:Sned1	APN	1	93274403	missense	probably damaging	1.00
IGL01367:Sned1	APN	1	93283214	missense	probably benign	0.32
IGL02116:Sned1	APN	1	93281725	nonsense	probably null
IGL02195:Sned1	APN	1	93274160	missense	probably benign	0.03
IGL02390:Sned1	APN	1	93261664	missense	probably benign
IGL02423:Sned1	APN	1	93283600	missense	probably benign
IGL02451:Sned1	APN	1	93236208	splice site	probably benign
IGL02567:Sned1	APN	1	93274347	missense	probably damaging	0.96
IGL03184:Sned1	APN	1	93274668	missense	probably benign	0.01
IGL03328:Sned1	APN	1	93289367	missense	probably benign
R0257:Sned1	UTSW	1	93265097	missense	possibly damaging	0.75
R0372:Sned1	UTSW	1	93285951	splice site	probably benign
R0525:Sned1	UTSW	1	93271974	splice site	probably null
R0727:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0759:Sned1	UTSW	1	93272564	missense	probably damaging	1.00
R0965:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0968:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0969:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1006:Sned1	UTSW	1	93256392	missense	probably damaging	1.00
R1068:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1069:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1070:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1112:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1114:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1115:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1118:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1119:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1144:Sned1	UTSW	1	93280576	missense	probably damaging	0.98
R1228:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1230:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1231:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1340:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1382:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1383:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1394:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1395:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1397:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1414:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1430:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1432:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1473:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1503:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1563:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1565:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1689:Sned1	UTSW	1	93283372	missense	probably damaging	0.99
R1695:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1734:Sned1	UTSW	1	93259768	missense	probably damaging	1.00
R1764:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1767:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1896:Sned1	UTSW	1	93265047	missense	probably benign	0.16
R1916:Sned1	UTSW	1	93274162	missense	probably null	1.00
R1945:Sned1	UTSW	1	93271238	missense	probably benign	0.01
R1972:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R1973:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R2143:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2144:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2145:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2153:Sned1	UTSW	1	93274657	missense	probably benign	0.01
R2273:Sned1	UTSW	1	93281642	splice site	probably null
R2274:Sned1	UTSW	1	93281642	splice site	probably null
R2275:Sned1	UTSW	1	93281642	splice site	probably null
R2340:Sned1	UTSW	1	93256452	missense	probably damaging	0.98
R3237:Sned1	UTSW	1	93259003	missense	probably benign	0.21
R3747:Sned1	UTSW	1	93261751	missense	probably damaging	1.00
R3879:Sned1	UTSW	1	93265030	splice site	probably benign
R4281:Sned1	UTSW	1	93285855	nonsense	probably null
R4282:Sned1	UTSW	1	93285855	nonsense	probably null
R4356:Sned1	UTSW	1	93265391	splice site	probably null
R4358:Sned1	UTSW	1	93274659	missense	probably benign	0.01
R4677:Sned1	UTSW	1	93296297	unclassified	probably benign
R5291:Sned1	UTSW	1	93295724	missense	possibly damaging	0.80
R5340:Sned1	UTSW	1	93282757	missense	probably benign	0.09
R5542:Sned1	UTSW	1	93271602	missense	probably benign
R5582:Sned1	UTSW	1	93282361	missense	probably damaging	1.00
R5874:Sned1	UTSW	1	93265345	missense	probably damaging	1.00
R6159:Sned1	UTSW	1	93282937	missense	probably benign	0.00
R6175:Sned1	UTSW	1	93275474	splice site	probably null
R6445:Sned1	UTSW	1	93283596	missense	possibly damaging	0.89
R6631:Sned1	UTSW	1	93281652	missense	probably damaging	1.00
R7018:Sned1	UTSW	1	93284421	missense	probably damaging	1.00
R7035:Sned1	UTSW	1	93262130	missense	probably damaging	1.00
R7047:Sned1	UTSW	1	93285818	missense	possibly damaging	0.51
R7347:Sned1	UTSW	1	93281736	missense	probably damaging	1.00
R7427:Sned1	UTSW	1	93289358	missense	probably benign	0.11
R7581:Sned1	UTSW	1	93256545	missense	probably benign	0.00
R7679:Sned1	UTSW	1	93236038	missense	unknown
R7899:Sned1	UTSW	1	93274082	missense	probably benign	0.04
R8093:Sned1	UTSW	1	93274665	missense	possibly damaging	0.82
R8124:Sned1	UTSW	1	93282989	critical splice donor site	probably null
R8489:Sned1	UTSW	1	93283256	nonsense	probably null
X0025:Sned1	UTSW	1	93261687	missense	probably damaging	1.00
Z1176:Sned1	UTSW	1	93259042	missense	probably damaging	1.00
Z1177:Sned1	UTSW	1	93285820	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCATCCTCTTGCTGGACAAGCTAC -3'
(R):5'- TCCTGAAAAGCCTGACCAAGTGTG -3'

Sequencing Primer
(F):5'- TTGCTGGACAAGCTACTCAGAG -3'
(R):5'- GCCTATCCAGGGACAACAGAG -3'

Posted On

2014-01-05