Incidental Mutation 'R1113:Try4'
ID96932
Institutional Source Beutler Lab
Gene Symbol Try4
Ensembl Gene ENSMUSG00000054106
Gene Nametrypsin 4
Synonyms0910001B19Rik, Td
MMRRC Submission 039186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1113 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41302269-41305532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41305374 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 209 (Q209H)
Ref Sequence ENSEMBL: ENSMUSP00000031913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031913
AA Change: Q209H

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031913
Gene: ENSMUSG00000054106
AA Change: Q209H

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.72e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193013
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.0%
  • 20x: 82.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 9,005,620 E1423K probably benign Het
Angpt2 C T 8: 18,692,118 W474* probably null Het
Cln6 A G 9: 62,850,861 T301A probably damaging Het
D730048I06Rik T C 9: 35,789,089 T67A probably benign Het
G6pc2 A T 2: 69,220,226 D65V probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Map3k6 T C 4: 133,245,815 S395P probably damaging Het
Myo6 G A 9: 80,245,714 V210I probably damaging Het
Otoa C A 7: 121,125,443 C448* probably null Het
Prkcg G C 7: 3,329,106 K525N probably damaging Het
Pros1 G A 16: 62,913,865 D345N probably damaging Het
Prss47 T C 13: 65,051,816 H83R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tekt2 A T 4: 126,324,918 L14H probably damaging Het
Tnpo2 T C 8: 85,055,353 F857S probably damaging Het
Wdfy4 G A 14: 32,971,738 S2710L possibly damaging Het
Other mutations in Try4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Try4 APN 6 41305026 missense probably damaging 1.00
IGL02216:Try4 APN 6 41305031 missense probably benign
R0537:Try4 UTSW 6 41304362 missense probably benign
R0731:Try4 UTSW 6 41304367 missense probably benign 0.01
R1833:Try4 UTSW 6 41303431 missense probably damaging 0.98
R2246:Try4 UTSW 6 41305472 missense possibly damaging 0.80
R4131:Try4 UTSW 6 41305401 nonsense probably null
R4414:Try4 UTSW 6 41304971 missense possibly damaging 0.84
R5457:Try4 UTSW 6 41303421 missense probably damaging 1.00
R5707:Try4 UTSW 6 41305043 missense possibly damaging 0.65
R6023:Try4 UTSW 6 41303421 missense probably damaging 1.00
R7131:Try4 UTSW 6 41304403 missense probably benign 0.03
R7783:Try4 UTSW 6 41302295 missense possibly damaging 0.96
R8051:Try4 UTSW 6 41305062 missense probably damaging 0.99
RF007:Try4 UTSW 6 41305363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAACATGTCAGCCAGAACAGAGG -3'
(R):5'- GCCTGAACTGATGCTTTCGTGTACC -3'

Sequencing Primer
(F):5'- CCAGAACAGAGGATGGGCTAAC -3'
(R):5'- CCATGCAACATATTTGGAGATGTAGG -3'
Posted On2014-01-05