Incidental Mutation 'R0980:Olfr1066'
ID96934
Institutional Source Beutler Lab
Gene Symbol Olfr1066
Ensembl Gene ENSMUSG00000075181
Gene Nameolfactory receptor 1066
SynonymsMOR256-52P, GA_x6K02T2Q125-47925557-47924616, MOR188-8
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86455328-86456269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86455360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000097470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099885] [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000217586]
Predicted Effect probably benign
Transcript: ENSMUST00000099885
AA Change: T304A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097470
Gene: ENSMUSG00000075181
AA Change: T304A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213789
Predicted Effect probably benign
Transcript: ENSMUST00000216162
Predicted Effect probably benign
Transcript: ENSMUST00000217586
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Olfr1066
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr1066 APN 2 86455502 missense possibly damaging 0.92
IGL01668:Olfr1066 APN 2 86455402 missense probably damaging 1.00
IGL02016:Olfr1066 APN 2 86455497 missense probably damaging 0.99
R0396:Olfr1066 UTSW 2 86456019 missense possibly damaging 0.54
R0987:Olfr1066 UTSW 2 86455547 nonsense probably null
R1169:Olfr1066 UTSW 2 86455587 missense possibly damaging 0.85
R2001:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2002:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2265:Olfr1066 UTSW 2 86456214 missense possibly damaging 0.77
R3811:Olfr1066 UTSW 2 86455347 missense probably benign 0.21
R4579:Olfr1066 UTSW 2 86455515 missense probably damaging 0.99
R4726:Olfr1066 UTSW 2 86456236 missense possibly damaging 0.90
R4768:Olfr1066 UTSW 2 86455650 nonsense probably null
R4871:Olfr1066 UTSW 2 86455809 missense possibly damaging 0.95
R5304:Olfr1066 UTSW 2 86455435 missense probably damaging 1.00
R6037:Olfr1066 UTSW 2 86455789 missense probably benign 0.14
R6037:Olfr1066 UTSW 2 86455789 missense probably benign 0.14
R7080:Olfr1066 UTSW 2 86455491 nonsense probably null
R7223:Olfr1066 UTSW 2 86455867 missense possibly damaging 0.78
R7378:Olfr1066 UTSW 2 86456068 missense probably benign 0.10
R7465:Olfr1066 UTSW 2 86455806 missense probably benign 0.07
R7598:Olfr1066 UTSW 2 86455890 missense probably damaging 0.98
X0025:Olfr1066 UTSW 2 86455869 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATCTATCCACTAAAGAGCAATGGGGAGT -3'
(R):5'- TGTGGGTCCCACCTGACAGTT -3'

Sequencing Primer
(F):5'- TAAGAAATCAGTGCATGGTGTCTG -3'
(R):5'- TGTCATCGTCTTTTATGGGACTTTG -3'
Posted On2014-01-05