Incidental Mutation 'R1113:Cln6'
ID 96944
Institutional Source Beutler Lab
Gene Symbol Cln6
Ensembl Gene ENSMUSG00000032245
Gene Name ceroid-lipofuscinosis, neuronal 6
Synonyms D9Bwg1455e, 1810065L06Rik
MMRRC Submission 039186-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1113 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 62746067-62759288 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62758143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 301 (T301A)
Ref Sequence ENSEMBL: ENSMUSP00000034776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034776] [ENSMUST00000141821]
AlphaFold Q3U466
Predicted Effect probably damaging
Transcript: ENSMUST00000034776
AA Change: T301A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034776
Gene: ENSMUSG00000032245
AA Change: T301A

DomainStartEndE-ValueType
Pfam:CLN6 27 306 1.3e-167 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124984
AA Change: T183A
SMART Domains Protein: ENSMUSP00000115675
Gene: ENSMUSG00000032245
AA Change: T183A

DomainStartEndE-ValueType
Pfam:CLN6 1 64 1.3e-34 PFAM
Pfam:CLN6 68 189 2.7e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132250
Predicted Effect probably benign
Transcript: ENSMUST00000138276
Predicted Effect probably benign
Transcript: ENSMUST00000141821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156423
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.0%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants have progressive retinal atrophy, limb paralysis, and seizures that lead to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 8,982,984 (GRCm39) E1423K probably benign Het
Angpt2 C T 8: 18,742,134 (GRCm39) W474* probably null Het
G6pc2 A T 2: 69,050,570 (GRCm39) D65V probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Map3k6 T C 4: 132,973,126 (GRCm39) S395P probably damaging Het
Myo6 G A 9: 80,152,996 (GRCm39) V210I probably damaging Het
Otoa C A 7: 120,724,666 (GRCm39) C448* probably null Het
Pate6 T C 9: 35,700,385 (GRCm39) T67A probably benign Het
Prkcg G C 7: 3,377,622 (GRCm39) K525N probably damaging Het
Pros1 G A 16: 62,734,228 (GRCm39) D345N probably damaging Het
Prss47 T C 13: 65,199,630 (GRCm39) H83R probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Tekt2 A T 4: 126,218,711 (GRCm39) L14H probably damaging Het
Tnpo2 T C 8: 85,781,982 (GRCm39) F857S probably damaging Het
Try4 G T 6: 41,282,308 (GRCm39) Q209H possibly damaging Het
Wdfy4 G A 14: 32,693,695 (GRCm39) S2710L possibly damaging Het
Other mutations in Cln6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Cln6 APN 9 62,751,900 (GRCm39) missense probably damaging 0.98
IGL01601:Cln6 APN 9 62,754,252 (GRCm39) missense probably damaging 0.99
IGL02351:Cln6 APN 9 62,754,407 (GRCm39) missense probably benign 0.01
IGL02358:Cln6 APN 9 62,754,407 (GRCm39) missense probably benign 0.01
boost UTSW 9 62,754,375 (GRCm39) missense probably damaging 1.00
R1308:Cln6 UTSW 9 62,758,143 (GRCm39) missense probably damaging 1.00
R3690:Cln6 UTSW 9 62,754,252 (GRCm39) missense possibly damaging 0.87
R3746:Cln6 UTSW 9 62,754,284 (GRCm39) missense probably benign
R3898:Cln6 UTSW 9 62,757,934 (GRCm39) missense probably damaging 1.00
R4576:Cln6 UTSW 9 62,746,231 (GRCm39) missense probably benign 0.35
R4996:Cln6 UTSW 9 62,757,937 (GRCm39) missense probably damaging 0.98
R5027:Cln6 UTSW 9 62,754,375 (GRCm39) missense probably damaging 1.00
R6048:Cln6 UTSW 9 62,751,908 (GRCm39) missense probably damaging 1.00
R7348:Cln6 UTSW 9 62,756,458 (GRCm39) missense probably benign 0.14
R7450:Cln6 UTSW 9 62,757,912 (GRCm39) missense probably damaging 1.00
R7565:Cln6 UTSW 9 62,758,039 (GRCm39) missense possibly damaging 0.86
R7837:Cln6 UTSW 9 62,756,330 (GRCm39) missense
R7982:Cln6 UTSW 9 62,756,450 (GRCm39) missense possibly damaging 0.69
R9206:Cln6 UTSW 9 62,756,465 (GRCm39) missense probably benign 0.24
R9208:Cln6 UTSW 9 62,756,465 (GRCm39) missense probably benign 0.24
R9210:Cln6 UTSW 9 62,757,973 (GRCm39) missense probably damaging 1.00
R9212:Cln6 UTSW 9 62,757,973 (GRCm39) missense probably damaging 1.00
R9311:Cln6 UTSW 9 62,757,900 (GRCm39) missense probably damaging 1.00
R9369:Cln6 UTSW 9 62,754,431 (GRCm39) missense probably damaging 0.98
R9618:Cln6 UTSW 9 62,758,111 (GRCm39) missense probably damaging 0.99
R9627:Cln6 UTSW 9 62,754,303 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCACTAGGTGAGATGTTCCG -3'
(R):5'- TATCTCCATAAGGCCAGCCCAGTC -3'

Sequencing Primer
(F):5'- ACTTGGTCCAGGAGGATGC -3'
(R):5'- TTCCATCTTAAGTCCAAAGGGGG -3'
Posted On 2014-01-05