Incidental Mutation 'R0980:Ubap1'
ID96965
Institutional Source Beutler Lab
Gene Symbol Ubap1
Ensembl Gene ENSMUSG00000028437
Gene Nameubiquitin-associated protein 1
SynonymsNAG20, 2700092A01Rik
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41348996-41390525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41379832 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 349 (C349G)
Ref Sequence ENSEMBL: ENSMUSP00000103695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072866] [ENSMUST00000108060]
Predicted Effect probably damaging
Transcript: ENSMUST00000072866
AA Change: C349G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072643
Gene: ENSMUSG00000028437
AA Change: C349G

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
SCOP:d1ifya_ 387 430 5e-10 SMART
PDB:4AE4|B 388 502 1e-74 PDB
Blast:UBA 392 428 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108060
AA Change: C349G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103695
Gene: ENSMUSG00000028437
AA Change: C349G

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
PDB:4AE4|B 362 441 2e-50 PDB
SCOP:d1exja1 394 437 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132235
SMART Domains Protein: ENSMUSP00000123491
Gene: ENSMUSG00000028437

DomainStartEndE-ValueType
SCOP:d1ifya_ 68 111 2e-11 SMART
PDB:4AE4|B 69 140 2e-44 PDB
Blast:UBA 73 109 7e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154529
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Ubap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ubap1 APN 4 41379562 missense probably benign
IGL01413:Ubap1 APN 4 41387333 missense probably benign 0.04
IGL01418:Ubap1 APN 4 41387333 missense probably benign 0.04
IGL01867:Ubap1 APN 4 41379236 missense probably benign 0.00
IGL02535:Ubap1 APN 4 41379667 nonsense probably null
R0090:Ubap1 UTSW 4 41379826 missense probably damaging 0.98
R1941:Ubap1 UTSW 4 41378968 missense probably damaging 0.96
R2049:Ubap1 UTSW 4 41379257 missense probably damaging 1.00
R2142:Ubap1 UTSW 4 41379257 missense probably damaging 1.00
R2310:Ubap1 UTSW 4 41379341 missense possibly damaging 0.86
R3508:Ubap1 UTSW 4 41379163 missense probably damaging 1.00
R4118:Ubap1 UTSW 4 41371767 missense probably damaging 1.00
R4375:Ubap1 UTSW 4 41371850 critical splice donor site probably null
R5053:Ubap1 UTSW 4 41387315 nonsense probably null
R5121:Ubap1 UTSW 4 41379688 missense probably benign
R6137:Ubap1 UTSW 4 41379262 missense possibly damaging 0.60
R6820:Ubap1 UTSW 4 41379854 missense probably benign 0.00
R7393:Ubap1 UTSW 4 41379764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAGCACTTTCCATAGCACATCCTG -3'
(R):5'- CTGGGTTTGATCCCTAGCACTGAAG -3'

Sequencing Primer
(F):5'- ACATCCTGCCTCCGAAGTG -3'
(R):5'- AGCTGCCCTCAGGAAAAG -3'
Posted On2014-01-05