Incidental Mutation 'R1114:Mgat4a'
ID96973
Institutional Source Beutler Lab
Gene Symbol Mgat4a
Ensembl Gene ENSMUSG00000026110
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms9530018I07Rik, GnT-IVa
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37439340-37541016 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 37464406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000148047] [ENSMUST00000149791] [ENSMUST00000151952] [ENSMUST00000154819]
Predicted Effect probably benign
Transcript: ENSMUST00000042161
SMART Domains Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 75 380 5.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143636
SMART Domains Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 242 1.2e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148047
SMART Domains Protein: ENSMUSP00000118692
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 112 5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149791
SMART Domains Protein: ENSMUSP00000115778
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 62 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151952
SMART Domains Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 86 380 7.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154819
SMART Domains Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 71 371 4.8e-137 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Mgat4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mgat4a APN 1 37449123 nonsense probably null
IGL01720:Mgat4a APN 1 37444898 missense probably damaging 1.00
IGL02103:Mgat4a APN 1 37462926 missense possibly damaging 0.94
IGL03177:Mgat4a APN 1 37444887 missense probably damaging 1.00
R0090:Mgat4a UTSW 1 37490333 missense probably damaging 1.00
R0269:Mgat4a UTSW 1 37490307 missense possibly damaging 0.89
R0635:Mgat4a UTSW 1 37452294 missense probably benign 0.11
R1120:Mgat4a UTSW 1 37452581 missense probably damaging 1.00
R1466:Mgat4a UTSW 1 37464406 splice site probably benign
R1940:Mgat4a UTSW 1 37536037 critical splice donor site probably null
R2257:Mgat4a UTSW 1 37490313 missense probably benign 0.13
R2293:Mgat4a UTSW 1 37452592 missense probably damaging 0.99
R2370:Mgat4a UTSW 1 37464533 missense probably damaging 0.96
R2392:Mgat4a UTSW 1 37498704 missense probably damaging 1.00
R3952:Mgat4a UTSW 1 37450414 splice site probably benign
R4563:Mgat4a UTSW 1 37466579 missense probably damaging 1.00
R5424:Mgat4a UTSW 1 37466555 missense probably benign 0.01
R5494:Mgat4a UTSW 1 37454817 missense probably damaging 1.00
R5505:Mgat4a UTSW 1 37495954 missense probably benign 0.04
R5938:Mgat4a UTSW 1 37452263 missense probably damaging 0.99
R6237:Mgat4a UTSW 1 37456592 missense probably damaging 1.00
R6589:Mgat4a UTSW 1 37444895 missense probably damaging 0.99
R6817:Mgat4a UTSW 1 37449123 nonsense probably null
R6825:Mgat4a UTSW 1 37464434 nonsense probably null
R7402:Mgat4a UTSW 1 37454784 missense probably damaging 1.00
R7507:Mgat4a UTSW 1 37452527 missense probably damaging 1.00
R7789:Mgat4a UTSW 1 37490279 missense probably damaging 0.97
X0063:Mgat4a UTSW 1 37462890 critical splice donor site probably null
Z1177:Mgat4a UTSW 1 37490372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAACACATCCAGCGGTGAG -3'
(R):5'- TAAGGCAAGTGACATCCCACAGAGC -3'

Sequencing Primer
(F):5'- ttcatccacaagccttttcttc -3'
(R):5'- GCTGACATAATACAGCTAACCTTTC -3'
Posted On2014-01-05