Incidental Mutation 'R0980:Pgd'
ID96974
Institutional Source Beutler Lab
Gene Symbol Pgd
Ensembl Gene ENSMUSG00000028961
Gene Namephosphogluconate dehydrogenase
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0980 (G1)
Quality Score179
Status Not validated
Chromosome4
Chromosomal Location149149991-149166771 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 149154311 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084124]
Predicted Effect probably null
Transcript: ENSMUST00000084124
SMART Domains Protein: ENSMUSP00000081141
Gene: ENSMUSG00000028961

DomainStartEndE-ValueType
Pfam:NAD_binding_2 3 176 3.2e-52 PFAM
6PGD 180 470 7.75e-219 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124409
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 6-phosphogluconate dehydrogenase is the second dehydrogenase in the pentose phosphate shunt. Deficiency of this enzyme is generally asymptomatic, and the inheritance of this disorder is autosomal dominant. Hemolysis results from combined deficiency of 6-phosphogluconate dehydrogenase and 6-phosphogluconolactonase suggesting a synergism of the two enzymopathies. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Pgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Pgd APN 4 149156753 missense probably damaging 1.00
IGL02480:Pgd APN 4 149156618 missense probably damaging 1.00
IGL03028:Pgd APN 4 149161627 critical splice donor site probably null
IGL03370:Pgd APN 4 149165228 missense probably damaging 1.00
R0398:Pgd UTSW 4 149153882 missense probably damaging 1.00
R0601:Pgd UTSW 4 149156810 splice site probably benign
R1475:Pgd UTSW 4 149156775 missense probably benign 0.00
R3826:Pgd UTSW 4 149166004 splice site probably benign
R4531:Pgd UTSW 4 149156777 missense probably benign 0.01
R4832:Pgd UTSW 4 149156591 intron probably benign
R6352:Pgd UTSW 4 149160752 intron probably null
R6353:Pgd UTSW 4 149160752 intron probably null
R6485:Pgd UTSW 4 149156419 intron probably null
R6514:Pgd UTSW 4 149160752 intron probably null
R6519:Pgd UTSW 4 149150886 nonsense probably null
R6543:Pgd UTSW 4 149160752 intron probably null
R7153:Pgd UTSW 4 149161678 missense probably benign
Z1176:Pgd UTSW 4 149166679 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGAATTGGAGGACCTCTACAGACC -3'
(R):5'- TGAGTTGTTCTGTGCAATCCTTGCC -3'

Sequencing Primer
(F):5'- TCTACAGACCCCACCACAGG -3'
(R):5'- ACGTCCCTTTGAATTCCGAG -3'
Posted On2014-01-05