Incidental Mutation 'R1114:Cdh20'
ID96980
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Namecadherin 20
SynonymsCdh7
MMRRC Submission 039187-MU
Accession Numbers

Genbank: NM_011800

Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location104768529-104995481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104979014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 522 (D522G)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
Predicted Effect probably damaging
Transcript: ENSMUST00000062528
AA Change: D522G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: D522G

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.2746 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104953887 missense probably benign 0.05
IGL00743:Cdh20 APN 1 104947428 missense probably benign 0.06
IGL00848:Cdh20 APN 1 104934256 missense probably benign
IGL01393:Cdh20 APN 1 104934244 missense probably benign
IGL01396:Cdh20 APN 1 104947429 missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104934107 missense probably benign 0.05
IGL01612:Cdh20 APN 1 104994170 missense probably benign 0.02
IGL01947:Cdh20 APN 1 104993924 missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104941037 missense probably damaging 1.00
IGL02226:Cdh20 APN 1 104954091 splice site probably benign
IGL02318:Cdh20 APN 1 104954039 missense probably null 0.03
IGL02326:Cdh20 APN 1 104975039 missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104947465 missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104934098 start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104941257 missense probably damaging 1.00
3-1:Cdh20 UTSW 1 104947420 missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
IGL02991:Cdh20 UTSW 1 104934247 missense probably benign
R0178:Cdh20 UTSW 1 104975051 missense possibly damaging 0.82
R1401:Cdh20 UTSW 1 104947497 missense possibly damaging 0.65
R1502:Cdh20 UTSW 1 104954030 missense probably benign 0.06
R1764:Cdh20 UTSW 1 104934345 splice site probably benign
R2198:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104947414 missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104975015 missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104947474 missense probably damaging 1.00
R4243:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104942143 missense probably damaging 1.00
R4349:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104979089 missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104934310 missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104984685 missense probably damaging 0.99
R4795:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104941264 missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104984803 missense probably damaging 1.00
R5056:Cdh20 UTSW 1 104953997 missense probably benign 0.00
R5127:Cdh20 UTSW 1 104947348 missense probably damaging 1.00
R5269:Cdh20 UTSW 1 104934157 missense possibly damaging 0.67
R5563:Cdh20 UTSW 1 104947357 missense probably benign 0.29
R5634:Cdh20 UTSW 1 104975075 missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104984910 missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104934098 start codon destroyed probably null 0.49
R5933:Cdh20 UTSW 1 104984671 missense probably damaging 1.00
R6109:Cdh20 UTSW 1 104994014 missense probably damaging 1.00
R6521:Cdh20 UTSW 1 104942134 missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104984686 missense possibly damaging 0.95
R7169:Cdh20 UTSW 1 104947353 missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104993977 missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104954071 missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104970873 missense probably benign
R7535:Cdh20 UTSW 1 104975043 missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104941279 missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104941299 missense probably damaging 1.00
R7879:Cdh20 UTSW 1 104947322 critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104934173 missense probably benign 0.15
R7925:Cdh20 UTSW 1 104984748 missense probably damaging 0.99
R8257:Cdh20 UTSW 1 104994237 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGGCCCATGCACTTTGAATCCAC -3'
(R):5'- AGAGGGCACTCTTTGTCTTTGATGC -3'

Sequencing Primer
(F):5'- ATTATGCAGGACCTCGTGAC -3'
(R):5'- CTCCCTGTTATTAAAAAGCCTGG -3'
Posted On2014-01-05