Incidental Mutation 'R0980:Immt'
ID96983
Institutional Source Beutler Lab
Gene Symbol Immt
Ensembl Gene ENSMUSG00000052337
Gene Nameinner membrane protein, mitochondrial
Synonymsmitofilin, D830041H16Rik, P87/89, P89, P87, 1700082C19Rik, HMP
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0980 (G1)
Quality Score196
Status Not validated
Chromosome6
Chromosomal Location71831331-71877388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71874326 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064062] [ENSMUST00000101301] [ENSMUST00000114151] [ENSMUST00000166938] [ENSMUST00000166975] [ENSMUST00000207003]
Predicted Effect probably benign
Transcript: ENSMUST00000064062
AA Change: V557A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066181
Gene: ENSMUSG00000052337
AA Change: V557A

DomainStartEndE-ValueType
Pfam:Mitofilin 40 745 5e-207 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101301
AA Change: V546A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098859
Gene: ENSMUSG00000052337
AA Change: V546A

DomainStartEndE-ValueType
Pfam:Mitofilin 40 734 3.9e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114151
AA Change: V509A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109788
Gene: ENSMUSG00000052337
AA Change: V509A

DomainStartEndE-ValueType
Pfam:Mitofilin 40 697 1.3e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166938
AA Change: V479A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128967
Gene: ENSMUSG00000052337
AA Change: V479A

DomainStartEndE-ValueType
Pfam:Mitofilin 40 667 3.6e-166 PFAM
Predicted Effect silent
Transcript: ENSMUST00000166975
SMART Domains Protein: ENSMUSP00000128367
Gene: ENSMUSG00000052337

DomainStartEndE-ValueType
Pfam:Mitofilin 40 467 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205628
AA Change: V54A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect silent
Transcript: ENSMUST00000206330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206836
Predicted Effect silent
Transcript: ENSMUST00000207003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207015
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Immt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01974:Immt APN 6 71872858 missense probably damaging 0.99
IGL02085:Immt APN 6 71851836 missense probably benign 0.30
IGL02493:Immt APN 6 71844716 splice site probably benign
glut UTSW 6 71861040 missense probably damaging 1.00
P0045:Immt UTSW 6 71868617 missense possibly damaging 0.88
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0106:Immt UTSW 6 71851844 missense probably benign 0.22
R0565:Immt UTSW 6 71846483 splice site probably benign
R0671:Immt UTSW 6 71871557 missense possibly damaging 0.95
R0676:Immt UTSW 6 71851844 missense probably benign 0.22
R0718:Immt UTSW 6 71863172 missense probably damaging 1.00
R0789:Immt UTSW 6 71861067 missense probably damaging 1.00
R1332:Immt UTSW 6 71846272 splice site probably benign
R1688:Immt UTSW 6 71857011 missense probably damaging 1.00
R2106:Immt UTSW 6 71871515 missense possibly damaging 0.80
R2149:Immt UTSW 6 71844675 nonsense probably null
R3706:Immt UTSW 6 71862362 missense probably benign 0.01
R4393:Immt UTSW 6 71872800 missense probably benign 0.04
R4543:Immt UTSW 6 71851778 missense probably damaging 0.97
R4645:Immt UTSW 6 71856939 missense probably damaging 1.00
R4774:Immt UTSW 6 71852736 missense probably damaging 1.00
R5535:Immt UTSW 6 71852784 missense probably null 1.00
R5920:Immt UTSW 6 71863196 missense probably benign 0.18
R7002:Immt UTSW 6 71861040 missense probably damaging 1.00
R7266:Immt UTSW 6 71874705 missense probably benign 0.26
R7326:Immt UTSW 6 71846369 missense probably damaging 1.00
R8185:Immt UTSW 6 71872851 nonsense probably null
R8200:Immt UTSW 6 71871437 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCGTTTGCATACTCTGGATTTCAC -3'
(R):5'- AACGGGCTCTTAGGGTCTCTTCAC -3'

Sequencing Primer
(F):5'- CATACTCTGGATTTCACAGGAAGG -3'
(R):5'- CTTAGGGTCTCTTCACTGTATACC -3'
Posted On2014-01-05