Incidental Mutation 'R1114:Dusp12'
ID96986
Institutional Source Beutler Lab
Gene Symbol Dusp12
Ensembl Gene ENSMUSG00000026659
Gene Namedual specificity phosphatase 12
SynonymsT-DSP4, ESTM36, VH1, LMW-DSP4, mVH1, 1190004O14Rik
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170873498-170885540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 170881017 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 48 (V48G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027970] [ENSMUST00000046476] [ENSMUST00000163252] [ENSMUST00000170420] [ENSMUST00000172042] [ENSMUST00000180542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027970
AA Change: V118G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027970
Gene: ENSMUSG00000026659
AA Change: V118G

DomainStartEndE-ValueType
DSPc 26 167 1.23e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046476
AA Change: V118G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044320
Gene: ENSMUSG00000026659
AA Change: V118G

DomainStartEndE-ValueType
DSPc 26 157 5.96e-20 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163252
AA Change: S118R
SMART Domains Protein: ENSMUSP00000126676
Gene: ENSMUSG00000026659
AA Change: S118R

DomainStartEndE-ValueType
Pfam:DSPc 30 115 2e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000166393
AA Change: S118R
SMART Domains Protein: ENSMUSP00000130507
Gene: ENSMUSG00000026659
AA Change: S118R

DomainStartEndE-ValueType
Pfam:DSPc 31 121 8.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170420
AA Change: S122R
SMART Domains Protein: ENSMUSP00000129515
Gene: ENSMUSG00000026659
AA Change: S122R

DomainStartEndE-ValueType
PTPc_DSPc 26 136 4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171447
AA Change: V48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130683
Gene: ENSMUSG00000026659
AA Change: V48G

DomainStartEndE-ValueType
Pfam:DSPc 3 98 6.9e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171747
Predicted Effect probably benign
Transcript: ENSMUST00000172042
Predicted Effect probably benign
Transcript: ENSMUST00000180542
Meta Mutation Damage Score 0.9000 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Dusp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Dusp12 APN 1 170874473 missense probably damaging 1.00
IGL02718:Dusp12 APN 1 170880657 missense probably damaging 1.00
P0028:Dusp12 UTSW 1 170879817 nonsense probably null
R0040:Dusp12 UTSW 1 170880657 missense probably damaging 1.00
R0040:Dusp12 UTSW 1 170880657 missense probably damaging 1.00
R1833:Dusp12 UTSW 1 170874453 missense probably benign
R1850:Dusp12 UTSW 1 170880629 missense probably benign 0.12
R2138:Dusp12 UTSW 1 170880597 nonsense probably null
R2260:Dusp12 UTSW 1 170881011 missense probably damaging 1.00
R3972:Dusp12 UTSW 1 170879775 missense probably damaging 0.98
R4298:Dusp12 UTSW 1 170880629 missense probably benign 0.12
R4803:Dusp12 UTSW 1 170880606 missense possibly damaging 0.51
R6639:Dusp12 UTSW 1 170880674 missense probably damaging 1.00
R6674:Dusp12 UTSW 1 170879748 missense probably benign 0.13
R6981:Dusp12 UTSW 1 170880961 missense probably damaging 1.00
R7432:Dusp12 UTSW 1 170879776 nonsense probably null
R7861:Dusp12 UTSW 1 170874526 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGGACGTATCGACTTCGTATC -3'
(R):5'- AAATGAGCTGGGCACACTGCAC -3'

Sequencing Primer
(F):5'- Gacacacaccatacacacatac -3'
(R):5'- tgtgtagccctggtcactc -3'
Posted On2014-01-05