Incidental Mutation 'R0980:Cyp2a5'
ID96989
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 26839006 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect probably damaging
Transcript: ENSMUST00000005685
AA Change: R265G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: R265G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165641
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169007
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26840979 missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26837153 missense probably benign 0.00
R6186:Cyp2a5 UTSW 7 26843388 unclassified probably benign
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTGGATTTTGTGCCGACAGC -3'
(R):5'- ACAGTGAGGTAGGATACATGGCCC -3'

Sequencing Primer
(F):5'- GTGCCGACAGCTTCCTTG -3'
(R):5'- agtcatagcacaaccttgcc -3'
Posted On2014-01-05