Incidental Mutation 'R1114:Ssfa2'
ID96990
Institutional Source Beutler Lab
Gene Symbol Ssfa2
Ensembl Gene ENSMUSG00000027007
Gene Namesperm specific antigen 2
SynonymsCS1, CS-1, SPAG13, KRAP
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79635352-79672966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79657529 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 652 (E652G)
Ref Sequence ENSEMBL: ENSMUSP00000107418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
Predicted Effect probably damaging
Transcript: ENSMUST00000111784
AA Change: E652G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: E652G

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111785
AA Change: E652G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: E652G

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111788
AA Change: E652G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: E652G

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133266
Meta Mutation Damage Score 0.2193 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Ssfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ssfa2 APN 2 79657268 missense possibly damaging 0.94
IGL00792:Ssfa2 APN 2 79657463 missense probably benign 0.01
IGL00900:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL00902:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL01682:Ssfa2 APN 2 79635637 missense probably damaging 1.00
IGL01683:Ssfa2 APN 2 79670725 intron probably benign
IGL01832:Ssfa2 APN 2 79651418 missense possibly damaging 0.94
IGL02253:Ssfa2 APN 2 79660444 missense probably damaging 1.00
IGL02342:Ssfa2 APN 2 79660285 missense probably benign 0.01
IGL02420:Ssfa2 APN 2 79635642 missense probably damaging 0.99
IGL02445:Ssfa2 APN 2 79657498 missense probably damaging 0.98
IGL02649:Ssfa2 APN 2 79641959 splice site probably benign
IGL03242:Ssfa2 APN 2 79643471 nonsense probably null
IGL03266:Ssfa2 APN 2 79642190 critical splice donor site probably null
IGL03342:Ssfa2 APN 2 79660452 missense probably damaging 1.00
IGL03352:Ssfa2 APN 2 79645101 missense probably damaging 1.00
R0255:Ssfa2 UTSW 2 79660466 missense probably damaging 1.00
R0526:Ssfa2 UTSW 2 79657346 missense probably benign 0.01
R0543:Ssfa2 UTSW 2 79644506 missense possibly damaging 0.79
R1701:Ssfa2 UTSW 2 79636050 missense probably damaging 1.00
R1734:Ssfa2 UTSW 2 79657822 missense probably damaging 1.00
R1945:Ssfa2 UTSW 2 79662652 missense probably benign 0.03
R2188:Ssfa2 UTSW 2 79644923 missense probably benign 0.01
R2941:Ssfa2 UTSW 2 79635656 missense probably benign 0.19
R4087:Ssfa2 UTSW 2 79658347 nonsense probably null
R4107:Ssfa2 UTSW 2 79644831 missense probably damaging 0.97
R4355:Ssfa2 UTSW 2 79641998 missense probably benign 0.02
R4497:Ssfa2 UTSW 2 79657820 missense probably damaging 1.00
R4615:Ssfa2 UTSW 2 79662382 missense probably damaging 0.99
R4726:Ssfa2 UTSW 2 79662757 missense probably damaging 1.00
R5818:Ssfa2 UTSW 2 79644593 missense probably damaging 1.00
R5889:Ssfa2 UTSW 2 79657728 missense probably damaging 1.00
R6169:Ssfa2 UTSW 2 79645062 missense probably damaging 0.99
R6337:Ssfa2 UTSW 2 79655119 missense probably damaging 1.00
R6677:Ssfa2 UTSW 2 79655101 missense possibly damaging 0.92
R6709:Ssfa2 UTSW 2 79644932 missense probably benign 0.00
R6855:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R6856:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R7075:Ssfa2 UTSW 2 79635660 missense probably damaging 0.99
R7319:Ssfa2 UTSW 2 79636072 missense probably damaging 1.00
R7414:Ssfa2 UTSW 2 79644728 missense possibly damaging 0.95
R7590:Ssfa2 UTSW 2 79658110 missense possibly damaging 0.88
R7722:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
R7923:Ssfa2 UTSW 2 79662615 nonsense probably null
R8155:Ssfa2 UTSW 2 79644833 missense probably benign 0.01
R8175:Ssfa2 UTSW 2 79658152 missense probably damaging 1.00
R8237:Ssfa2 UTSW 2 79657270 missense probably benign 0.01
R8341:Ssfa2 UTSW 2 79657718 missense probably damaging 1.00
R8353:Ssfa2 UTSW 2 79644785 missense probably benign 0.01
R8364:Ssfa2 UTSW 2 79651443 missense probably damaging 0.99
R8365:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACAACCAAGATTTCCCTCAGTG -3'
(R):5'- TAGCCAGCTTTTGCGAGCAAGTACC -3'

Sequencing Primer
(F):5'- AAGATTTCCCTCAGTGTGTGAC -3'
(R):5'- CGAGCAAGTACCTTTGTTTCAAC -3'
Posted On2014-01-05