Incidental Mutation 'R1114:Olfr1030'
ID96992
Institutional Source Beutler Lab
Gene Symbol Olfr1030
Ensembl Gene ENSMUSG00000044923
Gene Nameolfactory receptor 1030
SynonymsGA_x6K02T2Q125-47462755-47463693, MOR196-2
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85979276-85988294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85984307 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000053309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849]
Predicted Effect probably benign
Transcript: ENSMUST00000056849
AA Change: I156F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923
AA Change: I156F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Olfr1030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Olfr1030 APN 2 85984670 missense probably damaging 0.99
IGL01795:Olfr1030 APN 2 85984134 missense probably damaging 1.00
IGL02395:Olfr1030 APN 2 85984082 missense possibly damaging 0.76
IGL03277:Olfr1030 APN 2 85984173 missense probably damaging 0.99
PIT4468001:Olfr1030 UTSW 2 85984448 missense probably benign 0.10
R0458:Olfr1030 UTSW 2 85984256 missense probably benign 0.00
R1642:Olfr1030 UTSW 2 85983857 missense probably benign 0.00
R2189:Olfr1030 UTSW 2 85984068 missense probably damaging 1.00
R4094:Olfr1030 UTSW 2 85984218 missense probably damaging 1.00
R4246:Olfr1030 UTSW 2 85984280 missense possibly damaging 0.90
R4677:Olfr1030 UTSW 2 85983971 missense possibly damaging 0.61
R5537:Olfr1030 UTSW 2 85984226 missense possibly damaging 0.83
R6018:Olfr1030 UTSW 2 85984804 utr 3 prime probably benign
R6531:Olfr1030 UTSW 2 85984307 missense probably benign
R7367:Olfr1030 UTSW 2 85984343 missense possibly damaging 0.68
R7611:Olfr1030 UTSW 2 85984063 nonsense probably null
R7693:Olfr1030 UTSW 2 85984635 missense probably damaging 1.00
R7753:Olfr1030 UTSW 2 85984716 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTGACTCCCAAGATGCTGGTGAAC -3'
(R):5'- AGAACGCATCCTCAAGATGGCAATG -3'

Sequencing Primer
(F):5'- GAAAACCATTTCATATGCTGCG -3'
(R):5'- CATCCTCAAGATGGCAATGAGAATG -3'
Posted On2014-01-05