Incidental Mutation 'R0980:Cnga4'
ID96995
Institutional Source Beutler Lab
Gene Symbol Cnga4
Ensembl Gene ENSMUSG00000030897
Gene Namecyclic nucleotide gated channel alpha 4
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105404568-105408742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105408006 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 439 (P439T)
Ref Sequence ENSEMBL: ENSMUSP00000147387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033187] [ENSMUST00000210344]
Predicted Effect probably damaging
Transcript: ENSMUST00000033187
AA Change: P542T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033187
Gene: ENSMUSG00000030897
AA Change: P542T

DomainStartEndE-ValueType
Pfam:Ion_trans 34 276 1.1e-28 PFAM
cNMP 348 472 1.54e-25 SMART
low complexity region 500 508 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210344
AA Change: P439T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211108
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide-gated membrane channels that transduce odorant signals (Munger et al., 2001 [PubMed 11739959]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Inactivation of this gene results in odor adaptation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Cnga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cnga4 APN 7 105404962 missense probably benign
IGL01418:Cnga4 APN 7 105404962 missense probably benign
IGL02450:Cnga4 APN 7 105405748 missense probably damaging 1.00
IGL02533:Cnga4 APN 7 105407961 missense probably damaging 0.97
BB001:Cnga4 UTSW 7 105407821 missense probably benign 0.00
BB011:Cnga4 UTSW 7 105407821 missense probably benign 0.00
IGL03052:Cnga4 UTSW 7 105404725 missense probably benign 0.21
R0020:Cnga4 UTSW 7 105405677 missense probably damaging 1.00
R0135:Cnga4 UTSW 7 105406848 missense probably damaging 1.00
R0281:Cnga4 UTSW 7 105407668 missense probably damaging 1.00
R0506:Cnga4 UTSW 7 105407740 missense probably damaging 1.00
R0599:Cnga4 UTSW 7 105405818 missense probably damaging 1.00
R0646:Cnga4 UTSW 7 105404975 missense possibly damaging 0.47
R1727:Cnga4 UTSW 7 105405754 missense probably damaging 1.00
R3415:Cnga4 UTSW 7 105407118 missense probably damaging 1.00
R3768:Cnga4 UTSW 7 105407680 missense probably damaging 1.00
R4559:Cnga4 UTSW 7 105405685 missense probably damaging 1.00
R4852:Cnga4 UTSW 7 105405730 missense probably benign 0.01
R5081:Cnga4 UTSW 7 105407025 missense probably benign 0.20
R6232:Cnga4 UTSW 7 105407699 nonsense probably null
R6234:Cnga4 UTSW 7 105407699 nonsense probably null
R6235:Cnga4 UTSW 7 105407699 nonsense probably null
R6824:Cnga4 UTSW 7 105406829 missense probably benign
R6866:Cnga4 UTSW 7 105407745 missense possibly damaging 0.95
R6997:Cnga4 UTSW 7 105406983 missense probably damaging 1.00
R7019:Cnga4 UTSW 7 105405829 missense probably benign 0.00
R7273:Cnga4 UTSW 7 105406965 missense probably damaging 1.00
R7509:Cnga4 UTSW 7 105406890 missense probably benign 0.32
R7522:Cnga4 UTSW 7 105405988 missense probably damaging 0.99
R7545:Cnga4 UTSW 7 105407079 missense probably damaging 1.00
R7873:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R7924:Cnga4 UTSW 7 105407821 missense probably benign 0.00
R8024:Cnga4 UTSW 7 105406835 missense probably damaging 1.00
R8284:Cnga4 UTSW 7 105408032 missense probably benign 0.17
X0025:Cnga4 UTSW 7 105405220 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAACATGTCTGGAAACCGACGAAC -3'
(R):5'- TGCAGGCAGACTTTCCTACCACTC -3'

Sequencing Primer
(F):5'- TGCTGAGTGAGTACCCACAG -3'
(R):5'- ACCACTCTGGAATTACTTGAGCTG -3'
Posted On2014-01-05