Incidental Mutation 'R0980:Olfr488'
ID96999
Institutional Source Beutler Lab
Gene Symbol Olfr488
Ensembl Gene ENSMUSG00000096465
Gene Nameolfactory receptor 488
SynonymsGA_x6K02T2PBJ9-10586187-10585243, MOR204-15
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R0980 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location108251617-108258347 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GGTAG to GG at 108256022 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072968] [ENSMUST00000211345] [ENSMUST00000211508] [ENSMUST00000215173]
Predicted Effect probably benign
Transcript: ENSMUST00000072968
SMART Domains Protein: ENSMUSP00000072735
Gene: ENSMUSG00000096465

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 5.7e-53 PFAM
Pfam:7tm_1 44 293 2.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211345
Predicted Effect probably benign
Transcript: ENSMUST00000211508
Predicted Effect probably benign
Transcript: ENSMUST00000215173
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Olfr488
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Olfr488 APN 7 108255535 missense possibly damaging 0.89
IGL02510:Olfr488 APN 7 108256141 utr 5 prime probably benign
IGL02943:Olfr488 APN 7 108255416 missense possibly damaging 0.80
IGL02962:Olfr488 APN 7 108255703 missense possibly damaging 0.78
PIT4472001:Olfr488 UTSW 7 108256103 missense possibly damaging 0.46
R0981:Olfr488 UTSW 7 108256021 small deletion probably benign
R0981:Olfr488 UTSW 7 108256022 small deletion probably benign
R1957:Olfr488 UTSW 7 108255196 nonsense probably null
R3147:Olfr488 UTSW 7 108255676 missense possibly damaging 0.89
R4163:Olfr488 UTSW 7 108255832 missense probably benign 0.06
R4190:Olfr488 UTSW 7 108256123 missense probably benign
R4911:Olfr488 UTSW 7 108256037 missense possibly damaging 0.81
R5274:Olfr488 UTSW 7 108255635 missense probably benign 0.02
R5684:Olfr488 UTSW 7 108256039 missense possibly damaging 0.75
R6394:Olfr488 UTSW 7 108255763 missense possibly damaging 0.95
R6467:Olfr488 UTSW 7 108255902 missense probably damaging 0.99
R7173:Olfr488 UTSW 7 108255748 missense possibly damaging 0.78
R7317:Olfr488 UTSW 7 108255218 missense probably benign 0.00
R7348:Olfr488 UTSW 7 108256123 missense probably benign
R7485:Olfr488 UTSW 7 108255838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGATCATAAGCCATGACAGCCAG -3'
(R):5'- CATCACAGCCTTGATCTAGCAGCAG -3'

Sequencing Primer
(F):5'- TGAGCTGAGCTGAATGCCAC -3'
(R):5'- TGATCTAGCAGCAGCTATATTATCTC -3'
Posted On2014-01-05