Incidental Mutation 'R0980:Rexo5'
ID97003
Institutional Source Beutler Lab
Gene Symbol Rexo5
Ensembl Gene ENSMUSG00000030924
Gene NameRNA exonuclease 5
Synonyms2610020H08Rik
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119794006-119848943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119823812 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 289 (V289A)
Ref Sequence ENSEMBL: ENSMUSP00000102130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033218] [ENSMUST00000084644] [ENSMUST00000106520] [ENSMUST00000133758]
Predicted Effect probably damaging
Transcript: ENSMUST00000033218
AA Change: V289A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033218
Gene: ENSMUSG00000030924
AA Change: V289A

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Pfam:RNase_T 225 330 1.4e-12 PFAM
Blast:RRM 424 463 5e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000084644
AA Change: V97A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081694
Gene: ENSMUSG00000030924
AA Change: V97A

DomainStartEndE-ValueType
EXOIII 31 189 2.72e-29 SMART
RRM 298 367 3.23e-9 SMART
Blast:RRM 393 437 2e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106520
AA Change: V289A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102130
Gene: ENSMUSG00000030924
AA Change: V289A

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
EXOIII 223 381 2.72e-29 SMART
RRM 491 560 3.23e-9 SMART
RRM 586 661 3.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155938
Predicted Effect probably benign
Transcript: ENSMUST00000207042
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Rexo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rexo5 APN 7 119834276 missense probably damaging 1.00
R0347:Rexo5 UTSW 7 119823896 critical splice donor site probably null
R0442:Rexo5 UTSW 7 119843285 missense probably damaging 1.00
R0589:Rexo5 UTSW 7 119845383 missense probably benign 0.00
R1465:Rexo5 UTSW 7 119801358 critical splice donor site probably null
R1465:Rexo5 UTSW 7 119801358 critical splice donor site probably null
R1505:Rexo5 UTSW 7 119799603 nonsense probably null
R1775:Rexo5 UTSW 7 119845411 missense probably benign 0.00
R1911:Rexo5 UTSW 7 119799644 missense probably damaging 1.00
R1996:Rexo5 UTSW 7 119823857 missense probably damaging 1.00
R4168:Rexo5 UTSW 7 119827398 intron probably benign
R4169:Rexo5 UTSW 7 119827398 intron probably benign
R4402:Rexo5 UTSW 7 119834376 missense possibly damaging 0.82
R4486:Rexo5 UTSW 7 119825577 missense probably benign 0.00
R4620:Rexo5 UTSW 7 119827303 missense probably benign 0.37
R4621:Rexo5 UTSW 7 119819499 missense probably benign 0.19
R4865:Rexo5 UTSW 7 119801330 nonsense probably null
R4884:Rexo5 UTSW 7 119825551 nonsense probably null
R5171:Rexo5 UTSW 7 119823779 missense probably damaging 1.00
R5209:Rexo5 UTSW 7 119834299 nonsense probably null
R5266:Rexo5 UTSW 7 119844437 missense probably benign 0.00
R5463:Rexo5 UTSW 7 119834303 missense probably damaging 1.00
R5579:Rexo5 UTSW 7 119834403 critical splice donor site probably null
R6163:Rexo5 UTSW 7 119805247 missense probably damaging 1.00
R6305:Rexo5 UTSW 7 119828125 missense probably damaging 1.00
R7144:Rexo5 UTSW 7 119805191 missense probably damaging 1.00
R7282:Rexo5 UTSW 7 119818413 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- tctttttgacacctacatcatgtCCATGTTTT -3'
(R):5'- GAGCCAACTATATTCCCCTAATTCCTTCATTT -3'

Sequencing Primer
(F):5'- cctacatcatgtCCATGTTTTTCCTC -3'
(R):5'- GTTTTCCAGCATAAAGCAATGAGG -3'
Posted On2014-01-05