Incidental Mutation 'R0980:A430078G23Rik'
ID97005
Institutional Source Beutler Lab
Gene Symbol A430078G23Rik
Ensembl Gene ENSMUSG00000074497
Gene NameRIKEN cDNA A430078G23 gene
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0980 (G1)
Quality Score214
Status Not validated
Chromosome8
Chromosomal Location3353415-3390299 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 3389095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684] [ENSMUST00000098966] [ENSMUST00000145394] [ENSMUST00000208363]
Predicted Effect probably benign
Transcript: ENSMUST00000004684
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098966
AA Change: T484I
SMART Domains Protein: ENSMUSP00000096566
Gene: ENSMUSG00000074497
AA Change: T484I

DomainStartEndE-ValueType
low complexity region 116 134 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect probably benign
Transcript: ENSMUST00000145394
Predicted Effect probably benign
Transcript: ENSMUST00000208363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208845
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in A430078G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:A430078G23Rik APN 8 3381942 missense possibly damaging 0.62
IGL01743:A430078G23Rik APN 8 3364697 missense probably benign 0.01
IGL03334:A430078G23Rik APN 8 3388023 missense probably benign 0.04
R0417:A430078G23Rik UTSW 8 3388957 utr 3 prime probably benign
R0646:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R0759:A430078G23Rik UTSW 8 3388822 utr 3 prime probably benign
R0880:A430078G23Rik UTSW 8 3389032 utr 3 prime probably benign
R1175:A430078G23Rik UTSW 8 3389023 utr 3 prime probably benign
R1649:A430078G23Rik UTSW 8 3389094 utr 3 prime probably benign
R1781:A430078G23Rik UTSW 8 3380495 missense probably damaging 0.98
R2211:A430078G23Rik UTSW 8 3387680 missense possibly damaging 0.95
R2843:A430078G23Rik UTSW 8 3364634 missense possibly damaging 0.82
R5319:A430078G23Rik UTSW 8 3385010 critical splice donor site probably null
R5415:A430078G23Rik UTSW 8 3388075 missense probably damaging 0.99
R5588:A430078G23Rik UTSW 8 3388878 utr 3 prime probably benign
R6455:A430078G23Rik UTSW 8 3388753 missense probably benign 0.16
R7573:A430078G23Rik UTSW 8 3384918 missense probably damaging 0.96
R7664:A430078G23Rik UTSW 8 3386390 missense probably damaging 0.98
R7731:A430078G23Rik UTSW 8 3384936 missense probably damaging 0.99
R7845:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R8167:A430078G23Rik UTSW 8 3353636 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTGGCAGTCTTTCCTCGTATGCCT -3'
(R):5'- AGCCCAGCCTTGCCTAGCAGTTTT -3'

Sequencing Primer
(F):5'- TCCTCGTATGCCTTTCCATC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-01-05