Incidental Mutation 'R1114:Camk2d'
ID97006
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Namecalcium/calmodulin-dependent protein kinase II, delta
SynonymsCaMK II, 2810011D23Rik, 8030469K03Rik
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1114 (G1)
Quality Score172
Status Validated
Chromosome3
Chromosomal Location126596302-126846326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126840292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 488 (V488M)
Ref Sequence ENSEMBL: ENSMUSP00000143677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066452] [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000145454] [ENSMUST00000171289] [ENSMUST00000199300] [ENSMUST00000200171]
Predicted Effect probably damaging
Transcript: ENSMUST00000066452
AA Change: V136M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066996
Gene: ENSMUSG00000053819
AA Change: V136M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 356 483 9.4e-67 PFAM
Pfam:DUF4440 360 474 5.4e-13 PFAM
Pfam:SnoaL_3 360 486 3.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066466
AA Change: V468M

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819
AA Change: V468M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106399
AA Change: V488M
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819
AA Change: V488M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106400
AA Change: V454M

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819
AA Change: V454M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106401
AA Change: V464M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819
AA Change: V464M

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106402
AA Change: V488M

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819
AA Change: V488M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131869
SMART Domains Protein: ENSMUSP00000126412
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 1 109 5.1e-26 PFAM
Pfam:Pkinase_Tyr 3 111 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167417
SMART Domains Protein: ENSMUSP00000131124
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:CaMKII_AD 53 180 4.8e-68 PFAM
Pfam:DUF4440 57 171 8.2e-14 PFAM
Pfam:SnoaL_3 57 183 4.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167985
SMART Domains Protein: ENSMUSP00000126207
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:CaMKII_AD 59 130 2.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169051
SMART Domains Protein: ENSMUSP00000132554
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 6.9e-67 PFAM
Pfam:DUF4440 350 464 4.3e-13 PFAM
Pfam:SnoaL_3 350 476 2.8e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170149
AA Change: V144M
SMART Domains Protein: ENSMUSP00000130305
Gene: ENSMUSG00000053819
AA Change: V144M

DomainStartEndE-ValueType
Pfam:CaMKII_AD 37 164 3.1e-64 PFAM
Pfam:DUF4440 41 155 8.8e-13 PFAM
Pfam:SnoaL_3 41 167 1.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171289
AA Change: V488M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819
AA Change: V488M

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199300
AA Change: V454M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819
AA Change: V454M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200171
AA Change: V488M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819
AA Change: V488M

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197660
Meta Mutation Damage Score 0.6736 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126838272 nonsense probably null
IGL01113:Camk2d APN 3 126780412 missense probably damaging 1.00
IGL01125:Camk2d APN 3 126798285 splice site probably benign
IGL01912:Camk2d APN 3 126810632 splice site probably null
IGL01934:Camk2d APN 3 126834655 splice site probably null
IGL02184:Camk2d APN 3 126797773 missense probably damaging 0.97
IGL02218:Camk2d APN 3 126840153 missense probably benign 0.00
IGL02804:Camk2d APN 3 126797738 missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126796901 missense probably damaging 1.00
IGL03354:Camk2d APN 3 126796966 splice site probably null
baryon UTSW 3 126597482 nonsense probably null
neutron UTSW 3 126780420 missense probably damaging 1.00
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0628:Camk2d UTSW 3 126810624 splice site probably benign
R1433:Camk2d UTSW 3 126808224 missense probably benign 0.25
R2021:Camk2d UTSW 3 126780456 missense probably damaging 1.00
R2096:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2098:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2421:Camk2d UTSW 3 126780415 missense probably damaging 1.00
R2437:Camk2d UTSW 3 126834628 missense probably damaging 1.00
R2930:Camk2d UTSW 3 126808231 missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126771839 missense probably damaging 1.00
R3969:Camk2d UTSW 3 126796959 missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126780403 missense probably damaging 1.00
R4829:Camk2d UTSW 3 126779997 intron probably benign
R4916:Camk2d UTSW 3 126783975 missense probably damaging 1.00
R5277:Camk2d UTSW 3 126684741 intron probably benign
R5329:Camk2d UTSW 3 126597482 nonsense probably null
R5364:Camk2d UTSW 3 126780420 missense probably damaging 1.00
R5473:Camk2d UTSW 3 126597399 utr 5 prime probably benign
R5509:Camk2d UTSW 3 126840316 missense probably damaging 1.00
R5958:Camk2d UTSW 3 126779865 intron probably benign
R6010:Camk2d UTSW 3 126797714 missense possibly damaging 0.83
R6145:Camk2d UTSW 3 126805858 missense probably benign
R7267:Camk2d UTSW 3 126797730 missense possibly damaging 0.59
R7708:Camk2d UTSW 3 126597440 start codon destroyed probably benign 0.00
R8249:Camk2d UTSW 3 126797729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTAGCACAAATTGCCTCCC -3'
(R):5'- CATCAAGCCCAGGAGTGTTGAGAG -3'

Sequencing Primer
(F):5'- GTTCAGGCATGAATCAGCAC -3'
(R):5'- TGGCTGGAAATTAAGCATGACATC -3'
Posted On2014-01-05