Incidental Mutation 'R0980:Ankdd1a'
ID97013
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Nameankyrin repeat and death domain containing 1A
SynonymsLOC384945
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65488470-65520193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65516971 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 20 (H20R)
Ref Sequence ENSEMBL: ENSMUSP00000150130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
Predicted Effect probably damaging
Transcript: ENSMUST00000061766
AA Change: H10R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: H10R

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216282
Predicted Effect probably damaging
Transcript: ENSMUST00000217646
AA Change: H20R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65508702 missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65504139 missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65507611 splice site probably benign
IGL02150:Ankdd1a APN 9 65512719 missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65501470 missense probably benign 0.28
PIT4618001:Ankdd1a UTSW 9 65507650 missense possibly damaging 0.76
R0137:Ankdd1a UTSW 9 65510328 missense probably null 0.26
R0302:Ankdd1a UTSW 9 65509642 splice site probably benign
R1832:Ankdd1a UTSW 9 65504489 critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65502248 missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65505214 missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65502241 missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65509696 missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65520164 missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6313:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6314:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6413:Ankdd1a UTSW 9 65510372 missense probably benign
R6431:Ankdd1a UTSW 9 65516938 missense possibly damaging 0.92
R6477:Ankdd1a UTSW 9 65502212 missense probably benign 0.10
R6991:Ankdd1a UTSW 9 65508675 missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65504552 missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65502184 critical splice donor site probably null
X0064:Ankdd1a UTSW 9 65503453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTGGCTTGGAATCCTGAC -3'
(R):5'- AGGGTGGCACATTAAATCCACACAG -3'

Sequencing Primer
(F):5'- TCAGACCAGTTCAGGCAATG -3'
(R):5'- TCCACACAGTCATTCAACCTGG -3'
Posted On2014-01-05