Incidental Mutation 'R1114:Fabp3'
ID97018
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Namefatty acid binding protein 3, muscle and heart
SynonymsFabph4, Mdgi, H-FABP, Fabp3, Fabph1, Fabph-4, Fabph-1
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130308595-130315463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130312387 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000070709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
Predicted Effect probably benign
Transcript: ENSMUST00000070532
AA Change: T57I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: T57I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.7568 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130312387 missense probably benign 0.21
R1111:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1112:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1116:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1144:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1460:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1505:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1506:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1508:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1509:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1582:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1601:Fabp3 UTSW 4 130308848 missense probably benign 0.24
R1612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1641:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1664:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1670:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1686:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1690:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1709:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1854:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1855:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1935:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2107:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2208:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2211:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2392:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2393:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2829:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2830:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2831:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2901:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2964:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2975:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2979:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2980:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2981:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2982:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2983:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3430:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3613:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3614:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3755:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3756:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3825:Fabp3 UTSW 4 130312452 unclassified probably null
R3842:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4012:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4280:Fabp3 UTSW 4 130312452 unclassified probably null
R4282:Fabp3 UTSW 4 130312452 unclassified probably null
R4405:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4406:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4466:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4503:Fabp3 UTSW 4 130312452 unclassified probably null
R4547:Fabp3 UTSW 4 130312452 unclassified probably null
R4548:Fabp3 UTSW 4 130312452 unclassified probably null
R4671:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4681:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4710:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4743:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4850:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4989:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5015:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5133:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5134:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5549:Fabp3 UTSW 4 130315225 makesense probably null
R5884:Fabp3 UTSW 4 130312338 missense probably benign 0.01
R7170:Fabp3 UTSW 4 130313970 missense probably benign 0.06
R7967:Fabp3 UTSW 4 130313988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAAAATCTTCCAGGGGCAGGAC -3'
(R):5'- GCAGCACTGAGCAGGCTTTATGAAC -3'

Sequencing Primer
(F):5'- CAAAGACGTGGGCCACTG -3'
(R):5'- AGGCTTTATGAACCTGCCC -3'
Posted On2014-01-05