Incidental Mutation 'R0980:Proca1'
ID97033
Institutional Source Beutler Lab
Gene Symbol Proca1
Ensembl Gene ENSMUSG00000044122
Gene Nameprotein interacting with cyclin A1
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78193392-78205763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78204947 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 135 (H135P)
Ref Sequence ENSEMBL: ENSMUSP00000103953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317]
Predicted Effect probably benign
Transcript: ENSMUST00000002121
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078099
AA Change: H48P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122
AA Change: H48P

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Predicted Effect probably benign
Transcript: ENSMUST00000108317
AA Change: H135P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122
AA Change: H135P

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124772
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Proca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Proca1 APN 11 78204911 missense probably damaging 0.99
IGL01905:Proca1 APN 11 78204890 missense probably damaging 0.98
R0396:Proca1 UTSW 11 78194905 missense probably damaging 0.96
R0398:Proca1 UTSW 11 78205268 missense probably benign 0.00
R0734:Proca1 UTSW 11 78201802 splice site probably benign
R1899:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R1900:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R2183:Proca1 UTSW 11 78204149 missense possibly damaging 0.92
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R4237:Proca1 UTSW 11 78204926 missense probably benign 0.22
R4687:Proca1 UTSW 11 78204898 missense probably damaging 0.97
R5299:Proca1 UTSW 11 78205252 missense probably damaging 0.99
R5318:Proca1 UTSW 11 78201857 missense possibly damaging 0.92
R5379:Proca1 UTSW 11 78205266 missense probably damaging 0.99
R5564:Proca1 UTSW 11 78201873 missense possibly damaging 0.81
R6592:Proca1 UTSW 11 78204953 missense probably benign 0.00
R6796:Proca1 UTSW 11 78194928 missense probably benign
R6894:Proca1 UTSW 11 78194787 unclassified probably benign
R7423:Proca1 UTSW 11 78194817 unclassified probably benign
R8110:Proca1 UTSW 11 78204911 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGGTGATGGGACATAACTCCAAG -3'
(R):5'- TACGGATTGGCTCAGATCAGCAGG -3'

Sequencing Primer
(F):5'- TTCTTCCCAGGTGTAGAAGCCA -3'
(R):5'- GGAAGACTCCGACTTCACTG -3'
Posted On2014-01-05