Incidental Mutation 'R1114:Syt9'
ID 97034
Institutional Source Beutler Lab
Gene Symbol Syt9
Ensembl Gene ENSMUSG00000062542
Gene Name synaptotagmin IX
Synonyms Sytv
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1114 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 107370728-107548656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 107425355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 152 (V152F)
Ref Sequence ENSEMBL: ENSMUSP00000122049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]
AlphaFold Q9R0N9
Predicted Effect probably benign
Transcript: ENSMUST00000073459
AA Change: V152F

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: V152F

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 7e-54 BLAST
C2 236 339 1.8e-26 SMART
C2 368 482 1.6e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130414
AA Change: V152F

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542
AA Change: V152F

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 3e-57 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137663
SMART Domains Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Meta Mutation Damage Score 0.2609 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Syt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Syt9 APN 7 107425367 nonsense probably null
IGL00541:Syt9 APN 7 107502180 missense probably null 1.00
IGL01161:Syt9 APN 7 107425149 missense probably damaging 0.97
IGL01705:Syt9 APN 7 107436352 missense probably damaging 0.96
IGL02567:Syt9 APN 7 107436661 missense probably damaging 1.00
IGL03268:Syt9 APN 7 107436405 missense probably benign 0.01
R0684:Syt9 UTSW 7 107425136 missense probably damaging 1.00
R0743:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R0835:Syt9 UTSW 7 107506530 missense probably benign 0.30
R0884:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R1502:Syt9 UTSW 7 107436487 missense probably damaging 1.00
R1885:Syt9 UTSW 7 107436529 missense probably damaging 1.00
R1962:Syt9 UTSW 7 107425107 missense probably damaging 1.00
R2368:Syt9 UTSW 7 107436699 missense probably damaging 1.00
R2421:Syt9 UTSW 7 107436781 missense probably benign 0.39
R4134:Syt9 UTSW 7 107436423 missense probably benign 0.22
R4477:Syt9 UTSW 7 107425221 missense probably damaging 1.00
R4602:Syt9 UTSW 7 107436387 nonsense probably null
R4685:Syt9 UTSW 7 107436471 missense possibly damaging 0.89
R4977:Syt9 UTSW 7 107504272 missense probably damaging 1.00
R5141:Syt9 UTSW 7 107504219 missense probably damaging 1.00
R5421:Syt9 UTSW 7 107425356 missense probably benign 0.00
R5440:Syt9 UTSW 7 107502123 missense possibly damaging 0.46
R5633:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R5978:Syt9 UTSW 7 107436413 missense probably benign 0.02
R6260:Syt9 UTSW 7 107436510 missense possibly damaging 0.93
R6733:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R6889:Syt9 UTSW 7 107425286 missense probably damaging 0.99
R7572:Syt9 UTSW 7 107436577 missense probably damaging 1.00
R8080:Syt9 UTSW 7 107436790 missense probably benign
X0018:Syt9 UTSW 7 107506574 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCCATGAGCGACATCATCACACTG -3'
(R):5'- TCATGTTTCTGACTGAGTGGGCATC -3'

Sequencing Primer
(F):5'- CTGTTCTCTGGTAGCAAAGACAAC -3'
(R):5'- CTAGATTCTCAGCTAGTCAGTACCAC -3'
Posted On 2014-01-05