Mutagenetix > Incidental Mutation

Incidental Mutation 'R0980:Llgl2'

97037

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

039106-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.656) question?

Stock #

R0980 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115850001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 443 (E443G)

Ref Sequence

ENSEMBL: ENSMUSP00000099321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000173289] [ENSMUST00000177736]

AlphaFold

Q3TJ91

Predicted Effect

probably damaging
Transcript: ENSMUST00000103032
AA Change: E443G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: E443G

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000128826

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130518

Predicted Effect

probably benign
Transcript: ENSMUST00000133250

SMART Domains

Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	146	1e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137900

SMART Domains

Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	3e-20	BLAST
SCOP:d1gxra_	19	158	7e-9	SMART
Blast:WD40	62	101	6e-22	BLAST
Blast:WD40	112	157	2e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147878

Predicted Effect

probably benign
Transcript: ENSMUST00000155878

SMART Domains

Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	1e-20	BLAST
SCOP:d1gxra_	19	118	3e-8	SMART
Blast:WD40	62	101	3e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173289

SMART Domains

Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	148	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000177736
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: E443G

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.1%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	C	T	8: 3,389,095		probably benign	Het
Ankdd1a	T	C	9: 65,516,971	H20R	probably damaging	Het
Arfgef3	T	C	10: 18,592,118	E1778G	possibly damaging	Het
Blm	A	T	7: 80,499,958		probably null	Het
Ccr6	A	G	17: 8,256,014	E17G	probably benign	Het
Cep126	T	C	9: 8,100,719	T605A	probably damaging	Het
Cnga4	C	A	7: 105,408,006	P439T	probably damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Cyp2a5	A	G	7: 26,839,006		probably null	Het
D430041D05Rik	A	G	2: 104,249,345	V1131A	probably damaging	Het
Elp3	T	C	14: 65,577,953	T197A	probably damaging	Het
Etl4	A	G	2: 20,801,567	D1200G	probably damaging	Het
Gapt	G	C	13: 110,353,739	T130R	probably damaging	Het
Gprin1	T	C	13: 54,740,401	D20G	possibly damaging	Het
Hltf	T	C	3: 20,091,501	S432P	probably benign	Het
Immt	T	C	6: 71,874,326	V54A	probably benign	Het
Jhy	T	G	9: 40,944,837	Y118S	possibly damaging	Het
Kif23	C	A	9: 61,936,764	K154N	possibly damaging	Het
Krt79	T	C	15: 101,938,007	T169A	probably damaging	Het
Ltbp4	A	T	7: 27,324,162	C786S	probably damaging	Het
Mme	A	T	3: 63,340,129	E278D	probably benign	Het
Nt5c2	G	T	19: 46,898,878	Q162K	probably benign	Het
Obscn	A	G	11: 58,998,061	V2109A	possibly damaging	Het
Olfr1066	T	C	2: 86,455,360	T304A	probably benign	Het
Olfr1085	T	A	2: 86,657,865	I198L	probably benign	Het
Olfr488	GGTAG	GG	7: 108,256,022		probably benign	Het
Osmr	G	T	15: 6,852,440	N74K	probably benign	Het
Pes1	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	11: 3,977,636		probably benign	Het
Pgd	A	T	4: 149,154,311		probably null	Het
Pld1	T	A	3: 28,124,575	S873T	probably damaging	Het
Polk	A	T	13: 96,483,764	C664S	probably benign	Het
Proca1	A	C	11: 78,204,947	H135P	probably benign	Het
Ptgs2	A	C	1: 150,104,310	D333A	probably damaging	Het
Rexo5	T	C	7: 119,823,812	V289A	probably damaging	Het
Rnf125	T	A	18: 20,979,060	C49*	probably null	Het
Rprd2	C	A	3: 95,765,904	R729L	probably damaging	Het
Sipa1l1	A	G	12: 82,342,220	S407G	possibly damaging	Het
Slc35a4	C	A	18: 36,682,781	N221K	probably damaging	Het
Sorcs1	T	C	19: 50,232,323	D563G	probably benign	Het
Stk39	G	T	2: 68,392,171	T183K	probably damaging	Het
Tc2n	T	A	12: 101,678,576	K264*	probably null	Het
Trim23	C	T	13: 104,188,127	R238W	probably damaging	Het
Trim66	C	A	7: 109,455,670	V1240L	probably damaging	Het
Ttn	T	C	2: 76,754,045	T13913A	probably damaging	Het
Ubap1	T	G	4: 41,379,832	C349G	probably damaging	Het
Vmn1r170	A	T	7: 23,606,334	I54F	possibly damaging	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0097:Llgl2	UTSW	11	115844497	nonsense	probably null
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
R8076:Llgl2	UTSW	11	115846929	missense	possibly damaging	0.69
R8109:Llgl2	UTSW	11	115850793	missense	possibly damaging	0.52
R8129:Llgl2	UTSW	11	115850911	splice site	probably null
R8731:Llgl2	UTSW	11	115851190	missense	probably benign	0.01
R8881:Llgl2	UTSW	11	115853040	missense	probably benign	0.02
R9286:Llgl2	UTSW	11	115850018	missense	probably damaging	0.99
R9365:Llgl2	UTSW	11	115849581	missense	probably benign	0.01
R9560:Llgl2	UTSW	11	115834856	missense	probably damaging	0.99
R9651:Llgl2	UTSW	11	115852115	critical splice acceptor site	probably null
R9729:Llgl2	UTSW	11	115849641	missense	probably damaging	1.00
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTATGGGAACGCATCATCGC -3'
(R):5'- GGATCATCGCTGTAGGGATCAAAGG -3'

Sequencing Primer
(F):5'- TCTAGGAGTGGCCCATAGATG -3'
(R):5'- GGATCAAAGGAGCCCACCTG -3'

Posted On

2014-01-05