Incidental Mutation 'R0980:Sipa1l1'
ID97043
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0980 (G1)
Quality Score123
Status Not validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82342220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 407 (S407G)
Ref Sequence ENSEMBL: ENSMUSP00000152681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053969
AA Change: S407G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: S407G

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166429
AA Change: S407G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: S407G

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220766
Predicted Effect possibly damaging
Transcript: ENSMUST00000220963
AA Change: S407G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222298
AA Change: S407G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222714
AA Change: S407G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R1051:Sipa1l1 UTSW 12 82449345 missense possibly damaging 0.48
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R2909:Sipa1l1 UTSW 12 82357331 missense probably benign 0.39
R4012:Sipa1l1 UTSW 12 82341782 missense possibly damaging 0.86
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4651:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
R7469:Sipa1l1 UTSW 12 82420664 critical splice donor site probably null
R7718:Sipa1l1 UTSW 12 82342497 missense probably damaging 1.00
R7787:Sipa1l1 UTSW 12 82449988 missense possibly damaging 0.81
R7844:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7893:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R8043:Sipa1l1 UTSW 12 82449926 missense probably damaging 1.00
R8099:Sipa1l1 UTSW 12 82433826 missense probably benign 0.08
R8135:Sipa1l1 UTSW 12 82341301 missense probably benign
R8229:Sipa1l1 UTSW 12 82437848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTTTGCCCACTATGATGTCC -3'
(R):5'- TCCAGATGCAGCATCAAGCTTTCC -3'

Sequencing Primer
(F):5'- GCCCACTATGATGTCCAGAGC -3'
(R):5'- TCCTTGGGCACTTCGAGAAC -3'
Posted On2014-01-05