Incidental Mutation 'R0980:Gprin1'
ID97048
Institutional Source Beutler Lab
Gene Symbol Gprin1
Ensembl Gene ENSMUSG00000069227
Gene NameG protein-regulated inducer of neurite outgrowth 1
SynonymsGRIN1, Z16
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0980 (G1)
Quality Score178
Status Not validated
Chromosome13
Chromosomal Location54736671-54749874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54740401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000115539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145] [ENSMUST00000099506] [ENSMUST00000135343]
Predicted Effect probably benign
Transcript: ENSMUST00000037145
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099506
AA Change: D20G

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097106
Gene: ENSMUSG00000069227
AA Change: D20G

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 790 929 4.2e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135343
AA Change: D20G

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115539
Gene: ENSMUSG00000069227
AA Change: D20G

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 787 932 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Gprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Gprin1 APN 13 54740369 missense probably damaging 1.00
IGL02001:Gprin1 APN 13 54739192 missense probably damaging 1.00
IGL03188:Gprin1 APN 13 54738652 missense probably benign 0.02
IGL03308:Gprin1 APN 13 54740144 missense probably benign 0.05
R1638:Gprin1 UTSW 13 54739876 missense possibly damaging 0.53
R1942:Gprin1 UTSW 13 54739939 missense probably benign 0.36
R2145:Gprin1 UTSW 13 54738632 missense probably damaging 0.99
R2215:Gprin1 UTSW 13 54740233 missense probably damaging 0.99
R2338:Gprin1 UTSW 13 54738425 unclassified probably null
R3014:Gprin1 UTSW 13 54738475 missense probably benign 0.34
R4634:Gprin1 UTSW 13 54738058 missense probably damaging 1.00
R4732:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4733:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4903:Gprin1 UTSW 13 54737929 missense probably damaging 1.00
R4915:Gprin1 UTSW 13 54738073 missense probably damaging 1.00
R5102:Gprin1 UTSW 13 54739763 missense probably benign 0.06
R5979:Gprin1 UTSW 13 54739978 missense probably benign 0.01
R6544:Gprin1 UTSW 13 54740311 missense possibly damaging 0.46
R7007:Gprin1 UTSW 13 54738256 missense probably damaging 1.00
R7022:Gprin1 UTSW 13 54739042 missense probably benign 0.11
R7110:Gprin1 UTSW 13 54739243 missense probably benign 0.01
R7385:Gprin1 UTSW 13 54738610 missense probably benign 0.09
Z1176:Gprin1 UTSW 13 54740397 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGCTTCAGGGAGTTGCCATCCATC -3'
(R):5'- AGCGTCAGTTCTAAAGACCCAGCC -3'

Sequencing Primer
(F):5'- GAACACAGGATTTCTGATCTCTGAG -3'
(R):5'- TAAAGACCCAGCCTGGCTC -3'
Posted On2014-01-05