Incidental Mutation 'R1114:Scamp2'
ID97049
Institutional Source Beutler Lab
Gene Symbol Scamp2
Ensembl Gene ENSMUSG00000040188
Gene Namesecretory carrier membrane protein 2
SynonymsSc2
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57560943-57588795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57581580 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 188 (I188N)
Ref Sequence ENSEMBL: ENSMUSP00000038350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045791] [ENSMUST00000215942] [ENSMUST00000216986]
Predicted Effect probably damaging
Transcript: ENSMUST00000045791
AA Change: I188N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038350
Gene: ENSMUSG00000040188
AA Change: I188N

DomainStartEndE-ValueType
low complexity region 69 83 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Pfam:SCAMP 117 293 2.6e-68 PFAM
low complexity region 309 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213662
Predicted Effect probably benign
Transcript: ENSMUST00000215942
Predicted Effect probably benign
Transcript: ENSMUST00000216986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217200
Meta Mutation Damage Score 0.8987 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that the SCAMPs may function at the same site during vesicular transport rather than in separate pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Scamp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Scamp2 APN 9 57581620 nonsense probably null
IGL01932:Scamp2 APN 9 57561116 splice site probably benign
IGL02661:Scamp2 APN 9 57587414 unclassified probably benign
IGL02982:Scamp2 APN 9 57581549 missense probably benign
IGL03081:Scamp2 APN 9 57587127 missense possibly damaging 0.54
IGL03299:Scamp2 APN 9 57577740 splice site probably null
PIT4280001:Scamp2 UTSW 9 57580793 missense probably damaging 1.00
R2403:Scamp2 UTSW 9 57577712 missense possibly damaging 0.91
R4062:Scamp2 UTSW 9 57577262 critical splice donor site probably null
R4573:Scamp2 UTSW 9 57577194 missense probably damaging 1.00
R4859:Scamp2 UTSW 9 57581651 critical splice donor site probably null
R5449:Scamp2 UTSW 9 57580871 missense probably damaging 1.00
R6923:Scamp2 UTSW 9 57581612 missense probably damaging 0.99
R7123:Scamp2 UTSW 9 57587102 missense probably benign 0.02
R8220:Scamp2 UTSW 9 57577670 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAGAATTAGCCCAGGGTCTGCAC -3'
(R):5'- TCTGCTCCGAGTTGAGAAGAGGAAG -3'

Sequencing Primer
(F):5'- TCCCTGTATGAGGTCCTAGAGAAAC -3'
(R):5'- GAGGAAGGCAATTCCCTCC -3'
Posted On2014-01-05