Incidental Mutation 'R1114:Fbxw20'
ID97053
Institutional Source Beutler Lab
Gene Symbol Fbxw20
Ensembl Gene ENSMUSG00000061701
Gene NameF-box and WD-40 domain protein 20
Synonyms
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109217432-109234754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109223482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000078503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079548] [ENSMUST00000197329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079548
AA Change: V261A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078503
Gene: ENSMUSG00000061701
AA Change: V261A

DomainStartEndE-ValueType
FBOX 5 45 2.37e-6 SMART
SCOP:d1tbga_ 116 249 5e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197329
AA Change: V191A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143126
Gene: ENSMUSG00000061701
AA Change: V191A

DomainStartEndE-ValueType
FBOX 5 45 1.5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198261
Meta Mutation Damage Score 0.6866 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Fbxw20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Fbxw20 APN 9 109234702 start codon destroyed probably damaging 0.97
IGL01764:Fbxw20 APN 9 109223359 missense possibly damaging 0.71
IGL02149:Fbxw20 APN 9 109233818 critical splice donor site probably null
IGL02307:Fbxw20 APN 9 109233533 missense possibly damaging 0.70
IGL02335:Fbxw20 APN 9 109223309 missense possibly damaging 0.91
IGL02338:Fbxw20 APN 9 109225978 missense probably benign 0.00
PIT4377001:Fbxw20 UTSW 9 109221727 missense probably benign 0.00
PIT4434001:Fbxw20 UTSW 9 109223432 missense probably damaging 1.00
R0652:Fbxw20 UTSW 9 109232332 missense probably damaging 1.00
R1018:Fbxw20 UTSW 9 109221336 missense probably benign 0.03
R1596:Fbxw20 UTSW 9 109221300 missense probably damaging 1.00
R1692:Fbxw20 UTSW 9 109221709 missense possibly damaging 0.73
R1967:Fbxw20 UTSW 9 109217510 missense probably benign 0.00
R2055:Fbxw20 UTSW 9 109221374 missense probably damaging 0.99
R2224:Fbxw20 UTSW 9 109233582 missense possibly damaging 0.50
R4394:Fbxw20 UTSW 9 109232330 missense probably benign 0.00
R4617:Fbxw20 UTSW 9 109217563 missense probably damaging 1.00
R4858:Fbxw20 UTSW 9 109234695 missense possibly damaging 0.54
R5794:Fbxw20 UTSW 9 109223290 missense probably damaging 0.97
R5794:Fbxw20 UTSW 9 109233600 missense possibly damaging 0.95
R6090:Fbxw20 UTSW 9 109223363 missense probably benign 0.03
R7161:Fbxw20 UTSW 9 109225980 missense probably damaging 1.00
R7328:Fbxw20 UTSW 9 109232315 missense probably damaging 1.00
R8004:Fbxw20 UTSW 9 109221381 missense probably damaging 1.00
R8258:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
R8259:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
Z1177:Fbxw20 UTSW 9 109225887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCTCTATGAACCTTTCCTGAC -3'
(R):5'- GGACTCCATTCCACCTCTGAATGTG -3'

Sequencing Primer
(F):5'- ACGTCATGTCTGGATTGAGAAC -3'
(R):5'- CCACCTCTGAATGTGATGGG -3'
Posted On2014-01-05