Incidental Mutation 'R0980:Trim23'
ID97057
Institutional Source Beutler Lab
Gene Symbol Trim23
Ensembl Gene ENSMUSG00000021712
Gene Nametripartite motif-containing 23
Synonyms6330516O20Rik, Arfd1
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104178797-104203372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104188127 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 238 (R238W)
Ref Sequence ENSEMBL: ENSMUSP00000022225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000069174] [ENSMUST00000069187]
Predicted Effect probably damaging
Transcript: ENSMUST00000022225
AA Change: R238W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712
AA Change: R238W

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069174
AA Change: R218W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712
AA Change: R218W

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069187
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Trim23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Trim23 APN 13 104187612 missense probably benign 0.30
R0462:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R0638:Trim23 UTSW 13 104201309 missense probably benign 0.00
R1087:Trim23 UTSW 13 104188110 missense possibly damaging 0.66
R1764:Trim23 UTSW 13 104198618 missense probably damaging 1.00
R2441:Trim23 UTSW 13 104192075 missense probably damaging 1.00
R4006:Trim23 UTSW 13 104187623 missense probably benign 0.00
R4010:Trim23 UTSW 13 104181018 unclassified probably benign
R5162:Trim23 UTSW 13 104181174 missense probably damaging 0.98
R5383:Trim23 UTSW 13 104198697 missense probably damaging 1.00
R5389:Trim23 UTSW 13 104192033 missense probably damaging 0.96
R5520:Trim23 UTSW 13 104187527 missense probably damaging 1.00
R5539:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R5557:Trim23 UTSW 13 104187509 missense probably damaging 1.00
R7079:Trim23 UTSW 13 104187293 intron probably null
R7249:Trim23 UTSW 13 104188155 missense probably damaging 0.99
R7290:Trim23 UTSW 13 104187433 missense probably damaging 1.00
R7608:Trim23 UTSW 13 104192033 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACGAAGCCACTGTGACTGATGTTC -3'
(R):5'- CTCCAGCATGACTAATGGGTTCTGC -3'

Sequencing Primer
(F):5'- ATAGCATTCAGTACTGG -3'
(R):5'- cgtggtctttaactcttcaatttttc -3'
Posted On2014-01-05