Incidental Mutation 'R1114:Dctn2'
ID97058
Institutional Source Beutler Lab
Gene Symbol Dctn2
Ensembl Gene ENSMUSG00000025410
Gene Namedynactin 2
SynonymsRBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik
MMRRC Submission 039187-MU
Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1114 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location127266368-127281950 bp(+) (GRCm38)
Type of Mutationunclassified (4534 bp from exon)
DNA Base Change (assembly) T to A at 127278142 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078]
Predicted Effect probably null
Transcript: ENSMUST00000026476
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026479
AA Change: I317N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410
AA Change: I317N

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119078
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220418
Meta Mutation Damage Score 0.6524 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Dctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dctn2 APN 10 127277690 unclassified probably benign
IGL01749:Dctn2 APN 10 127281417 missense possibly damaging 0.47
IGL01797:Dctn2 APN 10 127277313 missense possibly damaging 0.94
IGL02021:Dctn2 APN 10 127275057 critical splice donor site probably null
IGL02335:Dctn2 APN 10 127275821 splice site probably benign
IGL02748:Dctn2 APN 10 127277273 missense probably damaging 1.00
IGL03382:Dctn2 APN 10 127278188 missense probably damaging 0.99
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0621:Dctn2 UTSW 10 127277940 critical splice donor site probably null
R1917:Dctn2 UTSW 10 127275049 nonsense probably null
R2238:Dctn2 UTSW 10 127276388 missense probably damaging 0.97
R4097:Dctn2 UTSW 10 127277493 missense probably damaging 1.00
R4418:Dctn2 UTSW 10 127278365 missense probably benign 0.24
R4972:Dctn2 UTSW 10 127276703 missense probably damaging 1.00
R6873:Dctn2 UTSW 10 127276236 intron probably null
R7533:Dctn2 UTSW 10 127267478 missense possibly damaging 0.87
R7557:Dctn2 UTSW 10 127278404 missense probably benign 0.44
R7657:Dctn2 UTSW 10 127266514 missense probably damaging 1.00
R8218:Dctn2 UTSW 10 127276529 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATTGCTAAGCACAAGGCATCCG -3'
(R):5'- AAGTGTGTCAGGAGCTGACCAAAC -3'

Sequencing Primer
(F):5'- CAAGGTCAGGAGCTGTCTTCTC -3'
(R):5'- TGACCAAACTGCATAGCTGC -3'
Posted On2014-01-05