Incidental Mutation 'R1114:Trmt2a'
ID97077
Institutional Source Beutler Lab
Gene Symbol Trmt2a
Ensembl Gene ENSMUSG00000022721
Gene NameTRM2 tRNA methyltransferase 2A
SynonymsHtf9c
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18248679-18254772 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 18250440 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115633] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect probably benign
Transcript: ENSMUST00000009321
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115645
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152033
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232015
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232342
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Trmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trmt2a APN 16 18249487 missense probably benign
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0377:Trmt2a UTSW 16 18249703 missense possibly damaging 0.68
R0699:Trmt2a UTSW 16 18249529 missense probably benign 0.01
R1034:Trmt2a UTSW 16 18249709 missense probably damaging 1.00
R1882:Trmt2a UTSW 16 18249894 missense possibly damaging 0.88
R1911:Trmt2a UTSW 16 18251206 missense probably benign 0.01
R2184:Trmt2a UTSW 16 18252995 missense probably benign 0.06
R3853:Trmt2a UTSW 16 18251191 missense possibly damaging 0.94
R4427:Trmt2a UTSW 16 18249229 unclassified probably benign
R4737:Trmt2a UTSW 16 18251286 unclassified probably benign
R4896:Trmt2a UTSW 16 18252929 missense probably damaging 0.99
R4903:Trmt2a UTSW 16 18249554 nonsense probably null
R4964:Trmt2a UTSW 16 18249554 nonsense probably null
R4966:Trmt2a UTSW 16 18249554 nonsense probably null
R5216:Trmt2a UTSW 16 18252184 missense probably benign 0.22
R5452:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R5837:Trmt2a UTSW 16 18249462 unclassified probably benign
R6555:Trmt2a UTSW 16 18253203 missense probably benign 0.03
R6670:Trmt2a UTSW 16 18250477 missense possibly damaging 0.57
R7064:Trmt2a UTSW 16 18253004 missense probably damaging 0.99
R7718:Trmt2a UTSW 16 18250623 missense probably benign 0.16
R8302:Trmt2a UTSW 16 18249949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGTCCATTAGCCATGTAAGC -3'
(R):5'- AGATTTGCCCAAGGGGTAACAGAAC -3'

Sequencing Primer
(F):5'- gcctaagaccatcagaaaacac -3'
(R):5'- CTGCTGGCTTATCAAACATTGG -3'
Posted On2014-01-05