Incidental Mutation 'R0980:Krt79'
ID97080
Institutional Source Beutler Lab
Gene Symbol Krt79
Ensembl Gene ENSMUSG00000061397
Gene Namekeratin 79
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0980 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101929332-101940324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101938007 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 169 (T169A)
Ref Sequence ENSEMBL: ENSMUSP00000023799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023799]
Predicted Effect probably damaging
Transcript: ENSMUST00000023799
AA Change: T169A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: T169A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 98 6.6e-11 PFAM
Pfam:Keratin_2_head 73 135 1.2e-21 PFAM
Filament 138 452 7.12e-159 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230441
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Krt79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Krt79 APN 15 101940166 missense probably damaging 0.98
IGL00546:Krt79 APN 15 101929873 missense probably benign 0.00
IGL01595:Krt79 APN 15 101931771 missense probably damaging 0.98
IGL02193:Krt79 APN 15 101939905 missense possibly damaging 0.59
R0639:Krt79 UTSW 15 101931548 nonsense probably null
R1839:Krt79 UTSW 15 101937938 missense possibly damaging 0.81
R4624:Krt79 UTSW 15 101939806 missense possibly damaging 0.92
R4745:Krt79 UTSW 15 101930684 missense probably damaging 1.00
R5203:Krt79 UTSW 15 101929740 missense unknown
R5382:Krt79 UTSW 15 101931440 missense probably benign 0.09
R5568:Krt79 UTSW 15 101929785 missense probably damaging 0.99
R6902:Krt79 UTSW 15 101931879 missense probably benign 0.08
R6916:Krt79 UTSW 15 101936170 missense probably benign 0.01
R6998:Krt79 UTSW 15 101937872 missense probably benign
R7009:Krt79 UTSW 15 101931441 missense probably damaging 1.00
R7663:Krt79 UTSW 15 101931843 missense probably damaging 0.97
R8161:Krt79 UTSW 15 101930702 missense not run
R8184:Krt79 UTSW 15 101929752 missense not run
R8206:Krt79 UTSW 15 101940270
Predicted Primers PCR Primer
(F):5'- ATGGCAAGAGCTTGGGGTTCAG -3'
(R):5'- TCCAGTTTCATCCGGGACAAGTGG -3'

Sequencing Primer
(F):5'- ACAAACAcgcccctgcc -3'
(R):5'- Gcacacacacacacacacac -3'
Posted On2014-01-05