Incidental Mutation 'R1114:Luc7l'
ID97085
Institutional Source Beutler Lab
Gene Symbol Luc7l
Ensembl Gene ENSMUSG00000024188
Gene NameLuc7-like
Synonyms
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26252910-26285504 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26275858 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025023] [ENSMUST00000114976] [ENSMUST00000119928] [ENSMUST00000140427] [ENSMUST00000148894] [ENSMUST00000152107] [ENSMUST00000154235]
Predicted Effect probably benign
Transcript: ENSMUST00000025023
SMART Domains Protein: ENSMUSP00000025023
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114976
SMART Domains Protein: ENSMUSP00000110627
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 5 249 2.5e-85 PFAM
low complexity region 327 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119928
SMART Domains Protein: ENSMUSP00000113405
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 4 260 3.1e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133032
Predicted Effect probably benign
Transcript: ENSMUST00000140427
SMART Domains Protein: ENSMUSP00000122258
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
Pfam:LUC7 1 168 1.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148894
Predicted Effect probably benign
Transcript: ENSMUST00000152107
SMART Domains Protein: ENSMUSP00000119717
Gene: ENSMUSG00000024188

DomainStartEndE-ValueType
coiled coil region 8 55 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a mutant allele producing a truncated product lacked any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Luc7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Luc7l APN 17 26279340 utr 3 prime probably benign
IGL02141:Luc7l APN 17 26253080 missense probably damaging 1.00
R0658:Luc7l UTSW 17 26266322 missense probably damaging 1.00
R1868:Luc7l UTSW 17 26280056 utr 3 prime probably benign
R2112:Luc7l UTSW 17 26255127 critical splice donor site probably null
R2286:Luc7l UTSW 17 26280046 utr 3 prime probably benign
R2864:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R2865:Luc7l UTSW 17 26266361 missense probably damaging 1.00
R3040:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4319:Luc7l UTSW 17 26277619 utr 3 prime probably benign
R4384:Luc7l UTSW 17 26279962 splice site probably benign
R5160:Luc7l UTSW 17 26267297 missense probably benign 0.27
R5330:Luc7l UTSW 17 26275733 nonsense probably null
R5331:Luc7l UTSW 17 26275733 nonsense probably null
R7220:Luc7l UTSW 17 26253245 start gained probably benign
R7418:Luc7l UTSW 17 26253182 unclassified probably benign
R7559:Luc7l UTSW 17 26255115 missense probably damaging 1.00
R8077:Luc7l UTSW 17 26255073 missense probably damaging 1.00
R8203:Luc7l UTSW 17 26266359 missense possibly damaging 0.95
X0026:Luc7l UTSW 17 26277575 missense probably damaging 1.00
Z1088:Luc7l UTSW 17 26267255 missense probably damaging 0.96
Z1177:Luc7l UTSW 17 26281661 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTGCATCCAGTTTTCAACAGC -3'
(R):5'- AAATGCTACAGGTCCTTCGAGCCC -3'

Sequencing Primer
(F):5'- GCAAAAACTCCGTGTTTGCG -3'
(R):5'- tccaccccacctcatcc -3'
Posted On2014-01-05