Incidental Mutation 'R0980:Ccr6'
ID97086
Institutional Source Beutler Lab
Gene Symbol Ccr6
Ensembl Gene ENSMUSG00000040899
Gene Namechemokine (C-C motif) receptor 6
SynonymsCmkbr6
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0980 (G1)
Quality Score214
Status Not validated
Chromosome17
Chromosomal Location8236043-8257141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8256014 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000156324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]
Predicted Effect probably benign
Transcript: ENSMUST00000097418
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164411
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166348
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167956
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177568
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180103
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: E17G

DomainStartEndE-ValueType
Pfam:7tm_1 55 308 6.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231340
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231545
AA Change: E17G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232412
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Slc35a4 C A 18: 36,682,781 N221K probably damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Ccr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ccr6 APN 17 8255993 missense probably benign 0.07
IGL02227:Ccr6 APN 17 8256452 missense probably damaging 1.00
IGL02339:Ccr6 APN 17 8256253 missense probably benign 0.01
E0374:Ccr6 UTSW 17 8256452 missense probably damaging 1.00
R0021:Ccr6 UTSW 17 8256766 missense possibly damaging 0.46
R0976:Ccr6 UTSW 17 8256422 missense probably damaging 1.00
R1141:Ccr6 UTSW 17 8256002 missense probably damaging 1.00
R1674:Ccr6 UTSW 17 8256217 missense probably damaging 0.99
R2117:Ccr6 UTSW 17 8256082 missense possibly damaging 0.75
R2176:Ccr6 UTSW 17 8256241 missense probably damaging 0.99
R4736:Ccr6 UTSW 17 8256064 nonsense probably null
R5050:Ccr6 UTSW 17 8256104 missense probably damaging 1.00
R5786:Ccr6 UTSW 17 8256412 missense probably damaging 0.99
R6138:Ccr6 UTSW 17 8256382 missense probably damaging 1.00
R6856:Ccr6 UTSW 17 8256049 missense probably benign 0.08
R6950:Ccr6 UTSW 17 8257066 makesense probably null
R7102:Ccr6 UTSW 17 8256187 missense probably benign 0.15
R7206:Ccr6 UTSW 17 8256949 missense probably benign
R7223:Ccr6 UTSW 17 8256140 missense probably damaging 1.00
R7323:Ccr6 UTSW 17 8256779 missense possibly damaging 0.88
R7737:Ccr6 UTSW 17 8245094 start gained probably benign
R8145:Ccr6 UTSW 17 8256113 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCTCTCCCATCCACATAGAGAAC -3'
(R):5'- TGGCATGAGTAACTGCCCAGAAC -3'

Sequencing Primer
(F):5'- AGAACCACGCCTGCCTG -3'
(R):5'- GGCCATGTTCAACAGGTAGAC -3'
Posted On2014-01-05