Incidental Mutation 'R1114:Xdh'
ID 97089
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 039187-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R1114 (G1)
Quality Score 144
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 74248144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,179 (GRCm39) noncoding transcript Het
Acss3 T A 10: 106,824,740 (GRCm39) R422S possibly damaging Het
Asb15 G A 6: 24,567,176 (GRCm39) R499H probably damaging Het
Aspm C T 1: 139,389,662 (GRCm39) probably benign Het
Camk2d G A 3: 126,633,941 (GRCm39) V488M probably damaging Het
Cd247 A G 1: 165,616,407 (GRCm39) K4E probably benign Het
Cdh20 A G 1: 104,906,739 (GRCm39) D522G probably damaging Het
Cse1l T A 2: 166,783,123 (GRCm39) probably benign Het
Dctn2 T A 10: 127,114,011 (GRCm39) probably null Het
Dpy19l1 A T 9: 24,336,072 (GRCm39) F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 (GRCm39) probably benign Het
Dsg4 A T 18: 20,599,540 (GRCm39) T719S possibly damaging Het
Dusp12 A C 1: 170,708,586 (GRCm39) V48G probably damaging Het
Efcab7 A T 4: 99,735,452 (GRCm39) R159* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbxw20 A G 9: 109,052,550 (GRCm39) V261A probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Inpp5j C A 11: 3,444,814 (GRCm39) R953L possibly damaging Het
Itprid2 A G 2: 79,487,873 (GRCm39) E652G probably damaging Het
Lrrk2 C T 15: 91,584,671 (GRCm39) R363* probably null Het
Ltbp1 A G 17: 75,667,770 (GRCm39) D1089G probably benign Het
Luc7l T C 17: 26,494,832 (GRCm39) probably benign Het
Mdn1 G A 4: 32,746,568 (GRCm39) probably null Het
Mgat4a A T 1: 37,503,487 (GRCm39) probably benign Het
Mmp12 A G 9: 7,358,289 (GRCm39) T392A possibly damaging Het
Nlrp12 A G 7: 3,277,166 (GRCm39) V921A probably benign Het
Or5m5 A T 2: 85,814,651 (GRCm39) I156F probably benign Het
Or5t7 G A 2: 86,507,629 (GRCm39) T16I possibly damaging Het
Or6c8b T A 10: 128,882,711 (GRCm39) I74F possibly damaging Het
Pkd2l1 T C 19: 44,179,983 (GRCm39) probably benign Het
Pramel24 A G 4: 143,453,425 (GRCm39) I178V probably benign Het
Rictor C A 15: 6,823,486 (GRCm39) C1554* probably null Het
Ryr2 A G 13: 11,960,867 (GRCm39) C24R probably damaging Het
Scamp2 T A 9: 57,488,863 (GRCm39) I188N probably damaging Het
Smg1 A T 7: 117,759,013 (GRCm39) probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Synrg C A 11: 83,914,262 (GRCm39) probably benign Het
Syt9 G T 7: 107,024,562 (GRCm39) V152F possibly damaging Het
Trmt2a A G 16: 18,068,304 (GRCm39) probably benign Het
Vmn2r100 T C 17: 19,752,261 (GRCm39) I831T probably damaging Het
Vps13a G T 19: 16,727,515 (GRCm39) H196N probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCCATTCATCAGCCAGGAAAG -3'
(R):5'- CATCTGTATGGTGCAGTTCAGCCTC -3'

Sequencing Primer
(F):5'- GGAGTCTTCTTGGAAACACAC -3'
(R):5'- TCAGCCTCATGGATTGAGGAG -3'
Posted On 2014-01-05