Incidental Mutation 'R1114:Vps13a'
ID97095
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 039187-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16750151 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000068716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect probably benign
Transcript: ENSMUST00000068156
AA Change: H196N

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: H196N

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223846
Predicted Effect probably benign
Transcript: ENSMUST00000224149
AA Change: H196N

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225764
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Faster UTSW 19 16619485 missense probably damaging 1.00
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 splice site probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5866:Vps13a UTSW 19 16680023 missense probably benign 0.04
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 splice site probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R7861:Vps13a UTSW 19 16655304 missense probably damaging 1.00
R7909:Vps13a UTSW 19 16720430 nonsense probably null
R7939:Vps13a UTSW 19 16740791 missense possibly damaging 0.94
R8108:Vps13a UTSW 19 16640787 missense probably damaging 1.00
R8123:Vps13a UTSW 19 16647702 missense probably benign 0.01
R8134:Vps13a UTSW 19 16654354 missense possibly damaging 0.71
R8168:Vps13a UTSW 19 16749548 missense probably benign 0.09
R8272:Vps13a UTSW 19 16749845 critical splice donor site probably null
R8293:Vps13a UTSW 19 16668605 missense possibly damaging 0.81
R8303:Vps13a UTSW 19 16616906 missense probably benign 0.00
R8383:Vps13a UTSW 19 16723705 missense possibly damaging 0.83
R8386:Vps13a UTSW 19 16701119 critical splice donor site probably null
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z1177:Vps13a UTSW 19 16699113 critical splice acceptor site probably null
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATCTCAGAGTTCACATTCCAGTAAGCAAA -3'
(R):5'- GCTAACAGAACCTACTCTATTGTCTTGCC -3'

Sequencing Primer
(F):5'- ACATTCCAGTAAGCAAAGAGATTATC -3'
(R):5'- GACCAGTGAGTTCTTTGAAAGC -3'
Posted On2014-01-05