Incidental Mutation 'R0980:Slc35a4'
ID97096
Institutional Source Beutler Lab
Gene Symbol Slc35a4
Ensembl Gene ENSMUSG00000033272
Gene Namesolute carrier family 35, member A4
Synonyms
MMRRC Submission 039106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0980 (G1)
Quality Score151
Status Not validated
Chromosome18
Chromosomal Location36679215-36683861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36682781 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 221 (N221K)
Ref Sequence ENSEMBL: ENSMUSP00000140615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000115682] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000036158
AA Change: N221K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272
AA Change: N221K

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050476
AA Change: N221K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272
AA Change: N221K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115682
SMART Domains Protein: ENSMUSP00000111346
Gene: ENSMUSG00000044719

DomainStartEndE-ValueType
Blast:KISc 1 105 2e-10 BLAST
SCOP:d1bg2__ 1 105 3e-9 SMART
low complexity region 120 130 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
coiled coil region 354 385 N/A INTRINSIC
coiled coil region 433 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186538
AA Change: N221K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272
AA Change: N221K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,389,095 probably benign Het
Ankdd1a T C 9: 65,516,971 H20R probably damaging Het
Arfgef3 T C 10: 18,592,118 E1778G possibly damaging Het
Blm A T 7: 80,499,958 probably null Het
Ccr6 A G 17: 8,256,014 E17G probably benign Het
Cep126 T C 9: 8,100,719 T605A probably damaging Het
Cnga4 C A 7: 105,408,006 P439T probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cyp2a5 A G 7: 26,839,006 probably null Het
D430041D05Rik A G 2: 104,249,345 V1131A probably damaging Het
Elp3 T C 14: 65,577,953 T197A probably damaging Het
Etl4 A G 2: 20,801,567 D1200G probably damaging Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gprin1 T C 13: 54,740,401 D20G possibly damaging Het
Hltf T C 3: 20,091,501 S432P probably benign Het
Immt T C 6: 71,874,326 V54A probably benign Het
Jhy T G 9: 40,944,837 Y118S possibly damaging Het
Kif23 C A 9: 61,936,764 K154N possibly damaging Het
Krt79 T C 15: 101,938,007 T169A probably damaging Het
Llgl2 A G 11: 115,850,001 E443G probably damaging Het
Ltbp4 A T 7: 27,324,162 C786S probably damaging Het
Mme A T 3: 63,340,129 E278D probably benign Het
Nt5c2 G T 19: 46,898,878 Q162K probably benign Het
Obscn A G 11: 58,998,061 V2109A possibly damaging Het
Olfr1066 T C 2: 86,455,360 T304A probably benign Het
Olfr1085 T A 2: 86,657,865 I198L probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Osmr G T 15: 6,852,440 N74K probably benign Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Pgd A T 4: 149,154,311 probably null Het
Pld1 T A 3: 28,124,575 S873T probably damaging Het
Polk A T 13: 96,483,764 C664S probably benign Het
Proca1 A C 11: 78,204,947 H135P probably benign Het
Ptgs2 A C 1: 150,104,310 D333A probably damaging Het
Rexo5 T C 7: 119,823,812 V289A probably damaging Het
Rnf125 T A 18: 20,979,060 C49* probably null Het
Rprd2 C A 3: 95,765,904 R729L probably damaging Het
Sipa1l1 A G 12: 82,342,220 S407G possibly damaging Het
Sorcs1 T C 19: 50,232,323 D563G probably benign Het
Stk39 G T 2: 68,392,171 T183K probably damaging Het
Tc2n T A 12: 101,678,576 K264* probably null Het
Trim23 C T 13: 104,188,127 R238W probably damaging Het
Trim66 C A 7: 109,455,670 V1240L probably damaging Het
Ttn T C 2: 76,754,045 T13913A probably damaging Het
Ubap1 T G 4: 41,379,832 C349G probably damaging Het
Vmn1r170 A T 7: 23,606,334 I54F possibly damaging Het
Other mutations in Slc35a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Slc35a4 APN 18 36682447 missense probably damaging 0.99
R1586:Slc35a4 UTSW 18 36683005 missense probably benign
R1723:Slc35a4 UTSW 18 36682735 missense possibly damaging 0.61
R3827:Slc35a4 UTSW 18 36682988 missense probably damaging 0.99
R5180:Slc35a4 UTSW 18 36682635 missense probably benign
R5732:Slc35a4 UTSW 18 36682341 missense probably benign 0.05
R7101:Slc35a4 UTSW 18 36681538 missense probably damaging 0.99
R7257:Slc35a4 UTSW 18 36679616 missense unknown
R7402:Slc35a4 UTSW 18 36680517 missense unknown
R7606:Slc35a4 UTSW 18 36682585 missense probably benign 0.01
R8299:Slc35a4 UTSW 18 36682927 missense possibly damaging 0.89
Z1088:Slc35a4 UTSW 18 36683093 makesense probably null
Z1176:Slc35a4 UTSW 18 36682763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGCTCTATTGTACTGCCTCTG -3'
(R):5'- TGCTGCTGCCATGCTTCATGAC -3'

Sequencing Primer
(F):5'- GCTTTCAGGAACCTGTGAAC -3'
(R):5'- TGCTTCATGACAGCCGAC -3'
Posted On2014-01-05