Incidental Mutation 'R0981:Gm13741'
ID97115
Institutional Source Beutler Lab
Gene Symbol Gm13741
Ensembl Gene ENSMUSG00000090018
Gene Namepredicted gene 13741
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R0981 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87656511-87658457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87656234 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 229 (N229S)
Ref Sequence ENSEMBL: ENSMUSP00000150358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099857] [ENSMUST00000135875] [ENSMUST00000213939]
Predicted Effect probably benign
Transcript: ENSMUST00000099854
AA Change: N229S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097440
Gene: ENSMUSG00000075154
AA Change: N229S

DomainStartEndE-ValueType
GHB 123 190 1.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099857
AA Change: N229S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097443
Gene: ENSMUSG00000111747
AA Change: N229S

DomainStartEndE-ValueType
GHB 123 190 1.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135875
AA Change: N229S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000213939
AA Change: N229S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fam71e2 T A 7: 4,757,589 probably null Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Glis1 A G 4: 107,615,042 E272G probably damaging Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Ofcc1 A G 13: 40,072,698 I786T probably damaging Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Pkd2l1 A G 19: 44,154,422 probably null Het
Plin5 C A 17: 56,114,020 R215L probably damaging Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Gm13741
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1423:Gm13741 UTSW 2 87656330 missense possibly damaging 0.95
R1612:Gm13741 UTSW 2 87656087 missense probably damaging 1.00
R8162:Gm13741 UTSW 2 87656102 missense possibly damaging 0.80
Z1088:Gm13741 UTSW 2 87656421 missense probably damaging 0.98
Z1088:Gm13741 UTSW 2 87656877 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGACACAGAATTTCACCCAGGC -3'
(R):5'- AGCTCTGCATCCAACTTGTGGC -3'

Sequencing Primer
(F):5'- AATATTGATTGCCTTCTTCAGAGCC -3'
(R):5'- AGGCTTGGTAGATTCAGCAATCC -3'
Posted On2014-01-05