Incidental Mutation 'R0981:Glis1'
ID 97132
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0981 (G1)
Quality Score 93
Status Not validated
Chromosome 4
Chromosomal Location 107434591-107635061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107615042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 272 (E272G)
Ref Sequence ENSEMBL: ENSMUSP00000102349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
AlphaFold Q8K1M4
Predicted Effect probably damaging
Transcript: ENSMUST00000046005
AA Change: E460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: E460G

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106738
AA Change: E272G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: E272G

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138211
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fam71e2 T A 7: 4,757,589 probably null Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Gm13741 T C 2: 87,656,234 N229S probably benign Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Ofcc1 A G 13: 40,072,698 I786T probably damaging Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Pkd2l1 A G 19: 44,154,422 probably null Het
Plin5 C A 17: 56,114,020 R215L probably damaging Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107627561 missense probably benign 0.01
IGL02450:Glis1 APN 4 107627529 missense probably benign 0.25
IGL03167:Glis1 APN 4 107435905 missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107615051 missense probably damaging 1.00
IGL03377:Glis1 APN 4 107632281 missense probably damaging 0.98
glenys UTSW 4 107627543 missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107568119 splice site probably null
R1036:Glis1 UTSW 4 107632264 missense probably benign 0.05
R1527:Glis1 UTSW 4 107567926 missense probably damaging 0.96
R1741:Glis1 UTSW 4 107568347 missense probably damaging 1.00
R2937:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107567845 missense probably benign 0.01
R4412:Glis1 UTSW 4 107634718 missense probably damaging 0.99
R4587:Glis1 UTSW 4 107627543 missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107567645 missense probably benign 0.00
R4900:Glis1 UTSW 4 107619564 missense probably damaging 1.00
R5138:Glis1 UTSW 4 107623105 frame shift probably null
R5167:Glis1 UTSW 4 107634694 missense probably damaging 1.00
R5511:Glis1 UTSW 4 107435877 missense probably damaging 0.99
R5568:Glis1 UTSW 4 107619635 missense probably damaging 0.99
R5807:Glis1 UTSW 4 107568082 missense probably benign 0.00
R6006:Glis1 UTSW 4 107567906 missense probably damaging 1.00
R6180:Glis1 UTSW 4 107627513 missense probably benign 0.06
R6219:Glis1 UTSW 4 107631905 missense probably benign 0.27
R6856:Glis1 UTSW 4 107435879 missense probably damaging 0.96
R7278:Glis1 UTSW 4 107435683 start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107634703 missense probably damaging 1.00
R7937:Glis1 UTSW 4 107627526 missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107632374 missense probably damaging 1.00
R7940:Glis1 UTSW 4 107632375 missense probably damaging 0.99
R7954:Glis1 UTSW 4 107619657 missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107567902 missense probably damaging 1.00
R8931:Glis1 UTSW 4 107563863 missense probably benign 0.35
R9227:Glis1 UTSW 4 107568130 missense probably benign 0.45
R9230:Glis1 UTSW 4 107568130 missense probably benign 0.45
R9767:Glis1 UTSW 4 107634597 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTCCCAGAGGCTTAGGAAAGCAG -3'
(R):5'- TTGAGTGAGAGCACCCAATTCCCC -3'

Sequencing Primer
(F):5'- AAGCAGCAGGTCGTTGG -3'
(R):5'- tgctacaactggaggatgac -3'
Posted On 2014-01-05