Mutagenetix > Incidental Mutation

Incidental Mutation 'R1115:Rasef'

97143

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

039188-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R1115 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73748604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 146 (T146K)

Ref Sequence

ENSEMBL: ENSMUSP00000099901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058292
AA Change: T218K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: T218K

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102837
AA Change: T146K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: T146K

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222414
AA Change: T299K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0695

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.8%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	C	A	11: 100,479,255	V994F	probably damaging	Het
Arfgap3	T	C	15: 83,330,540	T182A	probably benign	Het
Bcl2l14	T	C	6: 134,432,139		probably benign	Het
Cabin1	T	C	10: 75,717,677	M1183V	possibly damaging	Het
Ccr7	A	T	11: 99,145,277	I273K	possibly damaging	Het
Cd40	A	G	2: 165,070,761	M211V	possibly damaging	Het
Coro2b	T	G	9: 62,431,327	E208A	probably damaging	Het
Dennd5a	A	C	7: 109,918,761	M556R	probably damaging	Het
Efcab2	A	T	1: 178,437,497		probably benign	Het
Fam160a1	T	C	3: 85,722,495	E263G	probably benign	Het
Fastkd2	T	C	1: 63,747,955		probably benign	Het
Fbxw8	A	C	5: 118,077,571		probably benign	Het
Frem1	T	C	4: 83,020,770	D25G	probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Ift52	A	G	2: 163,029,782	K178R	probably benign	Het
Kit	T	C	5: 75,649,532		probably benign	Het
Map1a	T	C	2: 121,307,378		probably null	Het
Mxra7	G	T	11: 116,810,870		probably benign	Het
Myt1	C	A	2: 181,811,231	S7*	probably null	Het
Nphs1	C	T	7: 30,481,378		probably benign	Het
Olfr355	C	A	2: 36,927,502	G204V	possibly damaging	Het
Olfr63	C	T	17: 33,268,966	R81*	probably null	Het
Osgin2	A	T	4: 15,998,085	D512E	possibly damaging	Het
Pde4b	T	A	4: 102,542,155		probably benign	Het
Ren1	T	A	1: 133,356,518	V207D	probably damaging	Het
S100a8	A	G	3: 90,669,873	D59G	probably damaging	Het
Sdcbp	G	A	4: 6,377,143		probably null	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slamf7	A	T	1: 171,639,183	D151E	probably benign	Het
Slco1b2	A	G	6: 141,683,254	M561V	probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Stard9	T	C	2: 120,692,850	I662T	probably benign	Het
Vwf	T	A	6: 125,655,065	V20D	unknown	Het
Znhit6	G	T	3: 145,594,685		probably null	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1705:Rasef	UTSW	4	73744064	nonsense	probably null
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GCTGCAATGAGAAGACACAGTGACC -3'
(R):5'- AAGCTCACAGAGAAGAACTGGCTTG -3'

Sequencing Primer
(F):5'- CTAGTGACCTAAACACTGGGC -3'
(R):5'- TTACAGGTATTCTGATAGGGACCAG -3'

Posted On

2014-01-05