Incidental Mutation 'R0981:Fam71e2'
ID 97150
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Name family with sequence similarity 71, member E2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0981 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4753226-4771302 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 4757589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063324] [ENSMUST00000163574] [ENSMUST00000174409] [ENSMUST00000182048] [ENSMUST00000182111] [ENSMUST00000182173] [ENSMUST00000182738] [ENSMUST00000183334] [ENSMUST00000183971] [ENSMUST00000184143]
AlphaFold L7N480
Predicted Effect probably null
Transcript: ENSMUST00000063324
SMART Domains Protein: ENSMUSP00000064988
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108580
AA Change: Q708L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134691
Gene: ENSMUSG00000092518
AA Change: Q708L

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF3699 99 172 6.5e-23 PFAM
low complexity region 282 296 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174409
AA Change: Q708L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: Q708L

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182048
SMART Domains Protein: ENSMUSP00000138765
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182111
SMART Domains Protein: ENSMUSP00000138709
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182173
SMART Domains Protein: ENSMUSP00000138288
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182738
SMART Domains Protein: ENSMUSP00000138744
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183334
Predicted Effect probably null
Transcript: ENSMUST00000183971
SMART Domains Protein: ENSMUSP00000138911
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 75 1.7e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184143
SMART Domains Protein: ENSMUSP00000139239
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 60 2.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Glis1 A G 4: 107,615,042 E272G probably damaging Het
Gm13741 T C 2: 87,656,234 N229S probably benign Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Ofcc1 A G 13: 40,072,698 I786T probably damaging Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Pkd2l1 A G 19: 44,154,422 probably null Het
Plin5 C A 17: 56,114,020 R215L probably damaging Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R1428:Fam71e2 UTSW 7 4757688 missense possibly damaging 0.68
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5491:Fam71e2 UTSW 7 4757926 missense probably benign 0.05
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6025:Fam71e2 UTSW 7 4758144 missense probably benign 0.01
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6371:Fam71e2 UTSW 7 4759359 missense probably benign 0.06
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7037:Fam71e2 UTSW 7 4758585 utr 3 prime probably benign
R7381:Fam71e2 UTSW 7 4757682 missense
R8743:Fam71e2 UTSW 7 4757815 missense
R9066:Fam71e2 UTSW 7 4770519 intron probably benign
R9072:Fam71e2 UTSW 7 4759254 missense
R9138:Fam71e2 UTSW 7 4770407 missense
R9352:Fam71e2 UTSW 7 4758606 missense
R9373:Fam71e2 UTSW 7 4757713 missense
R9462:Fam71e2 UTSW 7 4758331 missense
Z1177:Fam71e2 UTSW 7 4757728 missense
Predicted Primers PCR Primer
(F):5'- ACCTAAGATAGGCCCAGTGGTGAG -3'
(R):5'- TGTTGAGAACCCCTACACAGAGGAC -3'

Sequencing Primer
(F):5'- CTTTAAGCTTTCAAAAACAGACATGG -3'
(R):5'- CCTACACAGAGGACAATAGGC -3'
Posted On 2014-01-05